Transcript: Mouse XM_006539854.3

PREDICTED: Mus musculus B9 protein domain 2 (B9d2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
B9d2 (232987)
Length:
2108
CDS:
1313..1840

Additional Resources:

NCBI RefSeq record:
XM_006539854.3
NBCI Gene record:
B9d2 (232987)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539854.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184487 GACCTGCACTTCGCTACTAAA pLKO.1 1496 CDS 100% 13.200 18.480 N B9d2 n/a
2 TRCN0000247521 GACCTGCACTTCGCTACTAAA pLKO_005 1496 CDS 100% 13.200 18.480 N B9d2 n/a
3 TRCN0000247525 ATCGCTATGGAGTGGAGTGTT pLKO_005 1818 CDS 100% 4.950 6.930 N B9d2 n/a
4 TRCN0000247524 TGCACGCAGATACCATCTACA pLKO_005 1716 CDS 100% 4.950 6.930 N B9d2 n/a
5 TRCN0000196139 GCACTTCGCTACTAAAGGTCT pLKO.1 1501 CDS 100% 2.640 2.112 N B9d2 n/a
6 TRCN0000247523 GGGACTTCATTGCTACTAATC pLKO_005 1841 CDS 100% 10.800 7.560 N B9d2 n/a
7 TRCN0000195896 CCATCATCCACTGAGCACATA pLKO.1 1863 3UTR 100% 4.950 3.465 N B9d2 n/a
8 TRCN0000247522 CAGCTTGCTGGCTATGGCTTT pLKO_005 1580 CDS 100% 4.050 2.430 N B9d2 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539854.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09049 pDONR223 100% 88% 96% None (many diffs) n/a
2 ccsbBroad304_09049 pLX_304 0% 88% 96% V5 (many diffs) n/a
3 TRCN0000472977 GAGCAGCCAAATAGGCTGCGAAAT pLX_317 67.1% 88% 96% V5 (many diffs) n/a
Download CSV