Transcript: Mouse XM_006540341.1

PREDICTED: Mus musculus carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8 (Chst8), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chst8 (68947)
Length:
1764
CDS:
111..1364

Additional Resources:

NCBI RefSeq record:
XM_006540341.1
NBCI Gene record:
Chst8 (68947)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540341.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103124 CCGCCTCAGTACCTACACCAA pLKO.1 827 CDS 100% 0.880 1.232 N Chst8 n/a
2 TRCN0000035097 CGACTTCTACTACATGGATTA pLKO.1 1301 CDS 100% 10.800 8.640 N CHST8 n/a
3 TRCN0000291298 CGACTTCTACTACATGGATTA pLKO_005 1301 CDS 100% 10.800 8.640 N CHST8 n/a
4 TRCN0000103123 CCAGCAAGTTCCAGGTATAAA pLKO.1 227 CDS 100% 15.000 10.500 N Chst8 n/a
5 TRCN0000103120 CGACTCGGATGGATGCTTTAA pLKO.1 1567 3UTR 100% 13.200 9.240 N Chst8 n/a
6 TRCN0000103122 CCTGATGTTCAACTACTCCAA pLKO.1 1322 CDS 100% 2.640 1.848 N Chst8 n/a
7 TRCN0000103121 CCTCAGTACCTACACCAAGAT pLKO.1 830 CDS 100% 4.950 2.970 N Chst8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540341.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03941 pDONR223 100% 82% 85.6% None (many diffs) n/a
2 ccsbBroad304_03941 pLX_304 0% 82% 85.6% V5 (many diffs) n/a
3 TRCN0000480331 TGTGCCTCATCCAGAACCACGTAT pLX_317 29.7% 82% 85.6% V5 (many diffs) n/a
Download CSV