Transcript: Mouse XM_006540381.3

PREDICTED: Mus musculus zinc finger protein 444 (Zfp444), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp444 (72667)
Length:
1770
CDS:
333..1328

Additional Resources:

NCBI RefSeq record:
XM_006540381.3
NBCI Gene record:
Zfp444 (72667)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540381.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311153 CAGATGGGTCGTCAGCAATGA pLKO_005 661 CDS 100% 4.950 6.930 N Zfp444 n/a
2 TRCN0000095120 GCAAAGCCACTCCGGTGAGAA pLKO.1 947 CDS 100% 1.650 2.310 N Zfp444 n/a
3 TRCN0000316394 GCAAAGCCACTCCGGTGAGAA pLKO_005 947 CDS 100% 1.650 2.310 N Zfp444 n/a
4 TRCN0000095123 GTGCGGGAAGTCTCCCTTGAA pLKO.1 902 CDS 100% 1.650 2.310 N Zfp444 n/a
5 TRCN0000316463 GTGCGGGAAGTCTCCCTTGAA pLKO_005 902 CDS 100% 1.650 2.310 N Zfp444 n/a
6 TRCN0000095122 CCGCGGTAGCTCAAGGGACTT pLKO.1 1255 CDS 100% 0.000 0.000 N Zfp444 n/a
7 TRCN0000095121 CGGCAAGGCATTCCGGCGTAA pLKO.1 989 CDS 100% 0.000 0.000 N Zfp444 n/a
8 TRCN0000316465 CGGCAAGGCATTCCGGCGTAA pLKO_005 989 CDS 100% 0.000 0.000 N Zfp444 n/a
9 TRCN0000304967 TGGTTCTCTCCATAGCCTAAA pLKO_005 1651 3UTR 100% 10.800 7.560 N Zfp444 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540381.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14197 pDONR223 98.8% 80% 84.4% None (many diffs) n/a
2 ccsbBroad304_14197 pLX_304 0% 80% 84.4% V5 (many diffs) n/a
3 TRCN0000467702 TCAATTATCACTAGGGGATGGATA pLX_317 21.8% 80% 84.4% V5 (many diffs) n/a
Download CSV