Transcript: Mouse XM_006540401.3

PREDICTED: Mus musculus signal-induced proliferation-associated 1 like 3 (Sipa1l3), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sipa1l3 (74206)
Length:
6212
CDS:
605..5953

Additional Resources:

NCBI RefSeq record:
XM_006540401.3
NBCI Gene record:
Sipa1l3 (74206)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540401.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106036 CCTCCCGGAAATATAGGTCTT pLKO.1 4595 CDS 100% 4.050 5.670 N Sipa1l3 n/a
2 TRCN0000106037 CCGCACACAACAAGCATTCAA pLKO.1 4935 CDS 100% 5.625 3.938 N Sipa1l3 n/a
3 TRCN0000106038 CCTAAAGAAGCTCATCGTCAT pLKO.1 5125 CDS 100% 4.050 2.835 N Sipa1l3 n/a
4 TRCN0000106039 CGACCTAAAGAAGCTCATCGT pLKO.1 5122 CDS 100% 2.640 1.848 N Sipa1l3 n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5849 CDS 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540401.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07837 pDONR223 100% 84% 87.9% None (many diffs) n/a
2 ccsbBroad304_07837 pLX_304 0% 84% 87.9% V5 (many diffs) n/a
3 TRCN0000480568 ACATAGCAAAACTGGCTAAGTTGC pLX_317 6.4% 84% 87.9% V5 (many diffs) n/a
Download CSV