Transcript: Mouse XM_006540411.3

PREDICTED: Mus musculus CAP-GLY domain containing linker protein 3 (Clip3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clip3 (76686)
Length:
3335
CDS:
185..1828

Additional Resources:

NCBI RefSeq record:
XM_006540411.3
NBCI Gene record:
Clip3 (76686)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540411.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226176 TGTTCGGCGTCCGGTACTTTA pLKO_005 1566 CDS 100% 13.200 18.480 N Clip3 n/a
2 TRCN0000252515 TTAGTCCATGGATCATCTAAT pLKO_005 2960 3UTR 100% 13.200 18.480 N Clip3 n/a
3 TRCN0000252516 ATTGCGTCAGAGAACTCTATC pLKO_005 1748 CDS 100% 10.800 8.640 N Clip3 n/a
4 TRCN0000226177 TCACCAGAAAGCCCTTATATT pLKO_005 2296 3UTR 100% 15.000 10.500 N Clip3 n/a
5 TRCN0000226175 CCTTCACTATGCCGCCTATTT pLKO_005 676 CDS 100% 13.200 9.240 N Clip3 n/a
6 TRCN0000218252 GATATGACACTGCTCCATTAT pLKO_005 536 CDS 100% 13.200 9.240 N Clip3 n/a
7 TRCN0000252514 AGGGCCGAAGAGAACACAAAG pLKO_005 1347 CDS 100% 10.800 7.560 N Clip3 n/a
8 TRCN0000226174 ATGTCATTGGCAACGAGATTC pLKO_005 474 CDS 100% 10.800 7.560 N Clip3 n/a
9 TRCN0000252513 GATGGACTTCTCCCGTGTAAC pLKO_005 1321 CDS 100% 10.800 7.560 N Clip3 n/a
10 TRCN0000258237 TCTATGGGAAGACTGACTTTG pLKO_005 1485 CDS 100% 10.800 7.560 N Clip3 n/a
11 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 236 CDS 100% 4.950 2.475 Y PTMA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540411.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02899 pDONR223 100% 89.3% 98.5% None (many diffs) n/a
2 ccsbBroad304_02899 pLX_304 0% 89.3% 98.5% V5 (many diffs) n/a
3 TRCN0000473374 GTACACACCTCTCGCAGCGCTAGG pLX_317 30.7% 89.3% 98.5% V5 (many diffs) n/a
Download CSV