Transcript: Mouse XM_006540559.3

PREDICTED: Mus musculus gamma-aminobutyric acid (GABA) A receptor, subunit alpha 5 (Gabra5), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gabra5 (110886)
Length:
2499
CDS:
173..1564

Additional Resources:

NCBI RefSeq record:
XM_006540559.3
NBCI Gene record:
Gabra5 (110886)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540559.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434778 AGAACGCGAACTCATACTAAA pLKO_005 1267 CDS 100% 13.200 18.480 N Gabra5 n/a
2 TRCN0000432765 GATGAAAGGCTGCGGTTTAAG pLKO_005 488 CDS 100% 13.200 18.480 N Gabra5 n/a
3 TRCN0000009901 CTACACCATGCGTCTGACAAT pLKO.1 658 CDS 100% 4.950 3.960 N Gabra5 n/a
4 TRCN0000009891 GAATAGAGAGCCCGTGATAAA pLKO.1 1522 CDS 100% 13.200 9.240 N Gabra5 n/a
5 TRCN0000009900 CACAACGGCAAGAAGTCCATT pLKO.1 578 CDS 100% 4.950 3.465 N Gabra5 n/a
6 TRCN0000009898 GTACAAGACGAGACCAATGAC pLKO.1 284 CDS 100% 4.950 3.465 N Gabra5 n/a
7 TRCN0000009899 GACGGACTCTTGGATGGCTAT pLKO.1 332 CDS 100% 4.050 2.835 N Gabra5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540559.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06241 pDONR223 100% 87.4% 94.8% None (many diffs) n/a
2 ccsbBroad304_06241 pLX_304 0% 87.4% 94.8% V5 (many diffs) n/a
3 TRCN0000467210 TATTTAGCACGCAAGAGCCGGAAC pLX_317 13.7% 87.4% 94.8% V5 (many diffs) n/a
Download CSV