Transcript: Mouse XM_006540578.1

PREDICTED: Mus musculus nuclear receptor subfamily 2, group F, member 2 (Nr2f2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nr2f2 (11819)
Length:
3622
CDS:
126..911

Additional Resources:

NCBI RefSeq record:
XM_006540578.1
NBCI Gene record:
Nr2f2 (11819)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540578.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054475 CTCGTACCTGTCCGGATATAT pLKO.1 191 CDS 100% 15.000 21.000 N Nr2f2 n/a
2 TRCN0000312204 CTCGTACCTGTCCGGATATAT pLKO_005 191 CDS 100% 15.000 21.000 N Nr2f2 n/a
3 TRCN0000026188 CGGATATATTTCCCTGCTGCT pLKO.1 203 CDS 100% 2.160 3.024 N Nr2f2 n/a
4 TRCN0000313186 ACAACCTGCTACTTATCATTT pLKO_005 1152 3UTR 100% 13.200 10.560 N Nr2f2 n/a
5 TRCN0000026167 GCCATATATGGCAATTCAATA pLKO.1 890 CDS 100% 13.200 10.560 N Nr2f2 n/a
6 TRCN0000313185 GCCATATATGGCAATTCAATA pLKO_005 890 CDS 100% 13.200 10.560 N Nr2f2 n/a
7 TRCN0000005096 CGTGATTGATTCAGTATCTTA pLKO.1 1941 3UTR 100% 5.625 4.500 N NR2F2 n/a
8 TRCN0000342600 CGTGATTGATTCAGTATCTTA pLKO_005 1941 3UTR 100% 5.625 4.500 N NR2F2 n/a
9 TRCN0000026203 CGAGTCTTTGTGTGTTATATT pLKO.1 2058 3UTR 100% 15.000 10.500 N Nr2f2 n/a
10 TRCN0000054474 CTCCTCAGTCATAGAGCAATT pLKO.1 788 CDS 100% 10.800 7.560 N Nr2f2 n/a
11 TRCN0000312253 CTCCTCAGTCATAGAGCAATT pLKO_005 788 CDS 100% 10.800 7.560 N Nr2f2 n/a
12 TRCN0000026232 AGCGAGCTGTTCGTGTTGAAT pLKO.1 414 CDS 100% 5.625 3.938 N Nr2f2 n/a
13 TRCN0000313261 AGCGAGCTGTTCGTGTTGAAT pLKO_005 414 CDS 100% 5.625 3.938 N Nr2f2 n/a
14 TRCN0000054473 CCCTTAGTTCTTGAATTGTTA pLKO.1 1797 3UTR 100% 5.625 3.938 N Nr2f2 n/a
15 TRCN0000005100 CCTCCTCAGTCATAGAGCAAT pLKO.1 787 CDS 100% 4.950 3.465 N NR2F2 n/a
16 TRCN0000342646 CCTCCTCAGTCATAGAGCAAT pLKO_005 787 CDS 100% 4.950 3.465 N NR2F2 n/a
17 TRCN0000054476 CGGTTCGGAAAGCTCTTGCTT pLKO.1 741 CDS 100% 3.000 2.100 N Nr2f2 n/a
18 TRCN0000054477 GACCACATACGGATCTTCCAA pLKO.1 534 CDS 100% 3.000 2.100 N Nr2f2 n/a
19 TRCN0000026164 CCAGTGTGCTTTGGAAGAGTA pLKO.1 689 CDS 100% 4.950 2.970 N Nr2f2 n/a
20 TRCN0000005099 CGGATATATTTCCCTGCTGTT pLKO.1 203 CDS 100% 4.050 5.670 N NR2F2 n/a
21 TRCN0000342644 CGGATATATTTCCCTGCTGTT pLKO_005 203 CDS 100% 4.050 5.670 N NR2F2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540578.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492178 TACGTTGGACATGGCCCACATCTG pLX_317 10.7% 52.1% 58.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489296 AGCCGAGAAACCGAAGATGCCCTT pLX_317 17.3% 52% 58.7% V5 (many diffs) n/a
Download CSV