Transcript: Mouse XM_006540605.2

PREDICTED: Mus musculus feline sarcoma oncogene (Fes), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fes (14159)
Length:
1658
CDS:
128..1573

Additional Resources:

NCBI RefSeq record:
XM_006540605.2
NBCI Gene record:
Fes (14159)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540605.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023608 GCAATACAAGGGTTGCAGATA pLKO.1 1214 CDS 100% 4.950 3.960 N Fes n/a
2 TRCN0000023604 CCCACACTGGAGATCCTTAAA pLKO.1 1426 CDS 100% 13.200 9.240 N Fes n/a
3 TRCN0000231270 CCTAGGCTTCCTGCGACAATA pLKO_005 910 CDS 100% 13.200 9.240 N Fes n/a
4 TRCN0000231268 GGAAGCTGAGCTGCGCTTATT pLKO_005 187 CDS 100% 13.200 9.240 N Fes n/a
5 TRCN0000231269 TCAAGAGTGACCGGGAATATG pLKO_005 240 CDS 100% 13.200 9.240 N Fes n/a
6 TRCN0000255348 TGCAGGAATACCTGGAGATTA pLKO_005 807 CDS 100% 13.200 9.240 N FES n/a
7 TRCN0000231271 ACCCACACTGGAGATCCTTAA pLKO_005 1425 CDS 100% 10.800 7.560 N Fes n/a
8 TRCN0000361198 AGATGCTGCAAGAGGCAATAC pLKO_005 1200 CDS 100% 10.800 7.560 N Fes n/a
9 TRCN0000023605 CGGGAATATGCAGGATTGCTT pLKO.1 251 CDS 100% 3.000 2.100 N Fes n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540605.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000479440 CCTAATGATTTCCCATTACAGGGA pLX_317 12.8% 48.7% 43.2% V5 (many diffs) n/a
2 ccsbBroadEn_14637 pDONR223 0% 48.7% 43.2% None (many diffs) n/a
3 ccsbBroad304_14637 pLX_304 0% 48.7% 43.2% V5 (many diffs) n/a
4 TRCN0000491795 CTCAGGGGGTATCAGACGTGAACA pLX_317 7.6% 48.7% 43.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV