Transcript: Mouse XM_006540799.3

PREDICTED: Mus musculus ubiquitin protein ligase E3A (Ube3a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ube3a (22215)
Length:
4784
CDS:
369..2981

Additional Resources:

NCBI RefSeq record:
XM_006540799.3
NBCI Gene record:
Ube3a (22215)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540799.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003368 CCTACATCTCATACTTGCTTT pLKO.1 2865 CDS 100% 4.950 6.930 N UBE3A n/a
2 TRCN0000012894 CCCAATGATGTATGATCTAAA pLKO.1 2423 CDS 100% 13.200 10.560 N Ube3a n/a
3 TRCN0000012893 CGGAGAATGATGGAAACATTT pLKO.1 1362 CDS 100% 13.200 9.240 N Ube3a n/a
4 TRCN0000012896 CCGGCTAGAGATGATTGCTAT pLKO.1 1967 CDS 100% 4.950 3.465 N Ube3a n/a
5 TRCN0000012895 CCTTCCTGAATGCACTTGTAT pLKO.1 1117 CDS 100% 5.625 3.375 N Ube3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540799.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11211 pDONR223 100% 63.4% 65.8% None (many diffs) n/a
2 ccsbBroad304_11211 pLX_304 0% 63.4% 65.8% V5 (many diffs) n/a
3 TRCN0000477716 TACAGATGGAACTAACACCTAAGA pLX_317 22.9% 63.4% 65.8% V5 (many diffs) n/a
Download CSV