Transcript: Mouse XM_006540902.1

PREDICTED: Mus musculus repulsive guidance molecule family member A (Rgma), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rgma (244058)
Length:
3254
CDS:
72..1388

Additional Resources:

NCBI RefSeq record:
XM_006540902.1
NBCI Gene record:
Rgma (244058)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540902.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126794 CGCAACAAGGTTGTGGTGATT pLKO.1 1676 3UTR 100% 4.950 6.930 N Rgma n/a
2 TRCN0000126797 TGGCCTCTCATCGACAATAAT pLKO.1 585 CDS 100% 15.000 12.000 N Rgma n/a
3 TRCN0000128608 CGACAATAATTACCTGAACGT pLKO.1 596 CDS 100% 2.640 2.112 N RGMA n/a
4 TRCN0000130653 CAAGATGCTCCACTCCAACAA pLKO.1 1223 CDS 100% 4.950 3.465 N RGMA n/a
5 TRCN0000126798 TCTGCCACTATGAGAAGAGTT pLKO.1 457 CDS 100% 4.950 3.465 N Rgma n/a
6 TRCN0000126796 CAGGACTTTCACAGACCACTT pLKO.1 539 CDS 100% 4.050 2.835 N Rgma n/a
7 TRCN0000126795 GCCTACTATGCTTTGGAGGAT pLKO.1 1200 CDS 100% 2.640 1.848 N Rgma n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540902.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08678 pDONR223 100% 86.5% 90.4% None (many diffs) n/a
2 ccsbBroad304_08678 pLX_304 0% 86.5% 90.4% V5 (many diffs) n/a
3 TRCN0000466660 AGCCGATCACTGAGGCTACCCGAG pLX_317 34.8% 86.5% 90.4% V5 (many diffs) n/a
Download CSV