Transcript: Mouse XM_006540907.3

PREDICTED: Mus musculus Hermansky-Pudlak syndrome 5 (Hps5), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hps5 (246694)
Length:
2356
CDS:
446..2218

Additional Resources:

NCBI RefSeq record:
XM_006540907.3
NBCI Gene record:
Hps5 (246694)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540907.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381619 GCATAGCTGTGTCTCGGAAAT pLKO_005 561 CDS 100% 10.800 15.120 N Hps5 n/a
2 TRCN0000380649 TGTAGTTGTTTGGGAATTAAA pLKO_005 739 CDS 100% 15.000 10.500 N Hps5 n/a
3 TRCN0000189637 CGTGTCTCTTCAGGCTGTTAA pLKO.1 2053 CDS 100% 13.200 9.240 N Hps5 n/a
4 TRCN0000381324 CAGTCAGTCCGACGAAGATTC pLKO_005 1825 CDS 100% 10.800 7.560 N Hps5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540907.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07781 pDONR223 100% 36.1% 35.4% None (many diffs) n/a
2 ccsbBroad304_07781 pLX_304 0% 36.1% 35.4% V5 (many diffs) n/a
3 TRCN0000468429 TCTCCGTCTACCTCTTCTCTCCCC pLX_317 13.6% 36.1% 35.4% V5 (many diffs) n/a
Download CSV