Transcript: Mouse XM_006541061.2

PREDICTED: Mus musculus synaptic vesicle glycoprotein 2 b (Sv2b), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sv2b (64176)
Length:
5427
CDS:
675..2726

Additional Resources:

NCBI RefSeq record:
XM_006541061.2
NBCI Gene record:
Sv2b (64176)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006541061.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112388 CGCCACGATCAACTTTACCAT pLKO.1 1985 CDS 100% 3.000 4.200 N Sv2b n/a
2 TRCN0000419829 AGTTCATCAACTGTCGGTTTA pLKO_005 2197 CDS 100% 10.800 7.560 N SV2B n/a
3 TRCN0000112385 CCCAAATCTAAACCAAACTAA pLKO.1 4300 3UTR 100% 5.625 3.938 N Sv2b n/a
4 TRCN0000112386 GCCTGGATGATTCTCAAACAA pLKO.1 1611 CDS 100% 5.625 3.938 N Sv2b n/a
5 TRCN0000112389 CACCAATATGAGACCATCATT pLKO.1 951 CDS 100% 5.625 3.375 N Sv2b n/a
6 TRCN0000112387 GCTCTGAAGTTCATGCCAGAA pLKO.1 1551 CDS 100% 4.050 2.430 N Sv2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006541061.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07507 pDONR223 100% 89.4% 94.8% None (many diffs) n/a
2 ccsbBroad304_07507 pLX_304 0% 89.4% 94.8% V5 (many diffs) n/a
3 TRCN0000471954 TTATTTTCTAGTAGTGGCCCTGGC pLX_317 18.7% 89.4% 94.8% V5 (many diffs) n/a
Download CSV