Transcript: Mouse XM_006541324.3

PREDICTED: Mus musculus non imprinted in Prader-Willi/Angelman syndrome 2 homolog (human) (Nipa2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nipa2 (93790)
Length:
3288
CDS:
578..1657

Additional Resources:

NCBI RefSeq record:
XM_006541324.3
NBCI Gene record:
Nipa2 (93790)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006541324.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255726 AGCCGGTGAAGTGGCCAATTT pLKO_005 778 CDS 100% 13.200 18.480 N Nipa2 n/a
2 TRCN0000124441 GCACACAGATTAATTACCTAA pLKO.1 1266 CDS 100% 4.950 6.930 N Nipa2 n/a
3 TRCN0000255727 ACCTCAGTACATGGCTAATTT pLKO_005 1838 3UTR 100% 15.000 10.500 N Nipa2 n/a
4 TRCN0000255728 AGAGGAGATTGAGACCTTAAA pLKO_005 976 CDS 100% 13.200 9.240 N Nipa2 n/a
5 TRCN0000124439 CCTCAAATAATGTCCTCTAAA pLKO.1 1735 3UTR 100% 13.200 9.240 N Nipa2 n/a
6 TRCN0000265687 TTTGTGGTCTTTGCAACATTT pLKO_005 1028 CDS 100% 13.200 9.240 N Nipa2 n/a
7 TRCN0000124442 GAATGGCAATCTTTCTAGTAT pLKO.1 1537 CDS 100% 5.625 3.938 N Nipa2 n/a
8 TRCN0000124443 CAGACAAACATTCTTGTGTAT pLKO.1 1100 CDS 100% 4.950 3.465 N Nipa2 n/a
9 TRCN0000124440 GCCATGCATATCTTAAGGAAT pLKO.1 726 CDS 100% 4.950 3.465 N Nipa2 n/a
10 TRCN0000142314 GTCATTCATGCTCCAAAGGAA pLKO.1 956 CDS 100% 3.000 2.100 N NIPA2 n/a
11 TRCN0000322926 GTCATTCATGCTCCAAAGGAA pLKO_005 956 CDS 100% 3.000 2.100 N NIPA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006541324.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09075 pDONR223 100% 90.2% 95.2% None (many diffs) n/a
2 ccsbBroad304_09075 pLX_304 0% 90.2% 95.2% V5 (many diffs) n/a
3 TRCN0000469676 GGTGTGATTTCAGTCACTTCGGTG pLX_317 41.7% 90.2% 95.2% V5 (many diffs) n/a
Download CSV