Transcript: Mouse XM_006541409.3

PREDICTED: Mus musculus NF-kappaB repressing factor (Nkrf), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nkrf (77286)
Length:
4813
CDS:
344..2698

Additional Resources:

NCBI RefSeq record:
XM_006541409.3
NBCI Gene record:
Nkrf (77286)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006541409.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123966 CGGAAGGAAGACCTACTAGAT pLKO.1 2618 CDS 100% 4.950 6.930 N Nkrf n/a
2 TRCN0000123967 CGACGGAAATTCAAGCACATA pLKO.1 1475 CDS 100% 4.950 3.960 N Nkrf n/a
3 TRCN0000123968 CGGAAGCAAATCCATCAGATT pLKO.1 2522 CDS 100% 4.950 3.960 N Nkrf n/a
4 TRCN0000123964 CCCTGTGATTTCCAGGATATT pLKO.1 3250 3UTR 100% 13.200 9.240 N Nkrf n/a
5 TRCN0000123965 CGGTTGAATATGTCTATGAAA pLKO.1 2019 CDS 100% 5.625 3.938 N Nkrf n/a
6 TRCN0000016429 GCTTGTGAAGTTAGATGCCAA pLKO.1 1346 CDS 100% 2.640 1.848 N NKRF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006541409.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03682 pDONR223 100% 80.2% 83.4% None (many diffs) n/a
2 ccsbBroad304_03682 pLX_304 0% 80.2% 83.4% V5 (many diffs) n/a
3 TRCN0000479332 AGTCTTGGGTAAGCCTTCCTAAAA pLX_317 19.7% 80.2% 83.4% V5 (many diffs) n/a
Download CSV