Transcript: Mouse XM_006541533.1

PREDICTED: Mus musculus ATPase, (Na+)/K+ transporting, beta 4 polypeptide (Atp1b4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atp1b4 (67821)
Length:
3877
CDS:
138..815

Additional Resources:

NCBI RefSeq record:
XM_006541533.1
NBCI Gene record:
Atp1b4 (67821)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006541533.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079905 CGTTACGTGATTAGCCTAAAT pLKO.1 270 CDS 100% 13.200 18.480 N Atp1b4 n/a
2 TRCN0000079906 CCTAGCCATCAGTCCTTACAT pLKO.1 146 CDS 100% 5.625 7.875 N Atp1b4 n/a
3 TRCN0000079907 GAAGCGAATCACAACTACTTA pLKO.1 13 5UTR 100% 5.625 7.875 N Atp1b4 n/a
4 TRCN0000436077 CAAGAAGGCCTGCCAATTTAA pLKO_005 389 CDS 100% 15.000 10.500 N Atp1b4 n/a
5 TRCN0000438493 AGGGCAAAGGCATCGTAAATG pLKO_005 736 CDS 100% 13.200 9.240 N Atp1b4 n/a
6 TRCN0000079903 CCGGAGTTACTTTCTCACAAA pLKO.1 2969 3UTR 100% 4.950 3.465 N Atp1b4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006541533.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02769 pDONR223 100% 57.7% 58.8% None (many diffs) n/a
2 ccsbBroad304_02769 pLX_304 0% 57.7% 58.8% V5 (many diffs) n/a
3 TRCN0000476479 GGGCACCTGCAGAACGCGGTTGTT pLX_317 35.3% 57.7% 58.8% V5 (many diffs) n/a
Download CSV