Transcript: Human XM_006710478.2

PREDICTED: Homo sapiens solute carrier family 35 member D1 (SLC35D1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC35D1 (23169)
Length:
6217
CDS:
404..1552

Additional Resources:

NCBI RefSeq record:
XM_006710478.2
NBCI Gene record:
SLC35D1 (23169)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006710478.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233166 GTACTCTGCACGCAGTATAAT pLKO_005 1304 CDS 100% 15.000 21.000 N SLC35D1 n/a
2 TRCN0000038545 GCGCTCAGAGTAGTCAAGTTT pLKO.1 677 CDS 100% 5.625 7.875 N SLC35D1 n/a
3 TRCN0000038546 CGCAGTATAATTCTGCTCTTA pLKO.1 1314 CDS 100% 4.950 6.930 N SLC35D1 n/a
4 TRCN0000038548 GCTCTATTACAATGCACTGTT pLKO.1 1060 CDS 100% 4.950 3.960 N SLC35D1 n/a
5 TRCN0000038547 GCAATGATTATTGGAGCCTTT pLKO.1 905 CDS 100% 4.050 3.240 N SLC35D1 n/a
6 TRCN0000233167 GGTCTTTGGTGGAGATTATAT pLKO_005 1387 CDS 100% 15.000 10.500 N SLC35D1 n/a
7 TRCN0000314076 TTCCACTACCTCTACTATATT pLKO_005 732 CDS 100% 15.000 10.500 N Slc35d1 n/a
8 TRCN0000233168 TTGCTGGGAGCCTGGTATATT pLKO_005 1446 CDS 100% 15.000 10.500 N SLC35D1 n/a
9 TRCN0000233165 CACCCTGGCCATTGCGTATTT pLKO_005 1093 CDS 100% 13.200 9.240 N SLC35D1 n/a
10 TRCN0000350053 CACCCTGGCCATTGCGTATTT pLKO_005 1093 CDS 100% 13.200 9.240 N Slc35d1 n/a
11 TRCN0000079507 CTATTACAATGCACTGTTCAT pLKO.1 1063 CDS 100% 4.950 3.465 N Slc35d1 n/a
12 TRCN0000038544 GCTAATAACAAGCTGGACATT pLKO.1 1511 CDS 100% 4.950 3.465 N SLC35D1 n/a
13 TRCN0000233169 CAGAGGATTGCTTCATCTGAT pLKO_005 1554 3UTR 100% 4.950 2.970 N SLC35D1 n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5565 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000152378 GAAACAGATCCTGAGTTCAAA pLKO.1 3218 3UTR 100% 5.625 3.938 N SLC22A20P n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5565 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006710478.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02726 pDONR223 100% 92.9% 92.9% None 728_808del n/a
2 ccsbBroad304_02726 pLX_304 0% 92.9% 92.9% V5 728_808del n/a
3 TRCN0000475667 GCGGTCCAATCCCCATATAGTTTT pLX_317 9.2% 92.9% 92.9% V5 728_808del n/a
Download CSV