Transcript: Human XM_006710585.3

PREDICTED: Homo sapiens ribosomal modification protein rimK like family member A (RIMKLA), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RIMKLA (284716)
Length:
12031
CDS:
133..795

Additional Resources:

NCBI RefSeq record:
XM_006710585.3
NBCI Gene record:
RIMKLA (284716)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006710585.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129324 CAAGGCAAGCAGTTGGCTATT pLKO.1 734 CDS 100% 10.800 8.640 N RIMKLA n/a
2 TRCN0000129728 CAGGATTGCTTCTGAGTTAAA pLKO.1 1162 3UTR 100% 13.200 9.240 N RIMKLA n/a
3 TRCN0000130144 CGAACCTGGCTACAACATTAA pLKO.1 1138 3UTR 100% 13.200 9.240 N RIMKLA n/a
4 TRCN0000128400 GCAGCATTTAAACCAAATCCT pLKO.1 1207 3UTR 100% 3.000 2.100 N RIMKLA n/a
5 TRCN0000129625 CCTACTGCTTCCCTAGTAGTT pLKO.1 1225 3UTR 100% 0.495 0.347 N RIMKLA n/a
6 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4057 3UTR 100% 10.800 5.400 Y SMIM11A n/a
7 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 10923 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006710585.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13535 pDONR223 100% 45.7% 40% None 1_123del;569_570ins116;660_661ins397 n/a
2 ccsbBroad304_13535 pLX_304 0% 45.7% 40% V5 1_123del;569_570ins116;660_661ins397 n/a
3 TRCN0000465970 AAATCCTAGTAACGCCCCAATATA pLX_317 37.8% 45.7% 40% V5 1_123del;569_570ins116;660_661ins397 n/a
Download CSV