Transcript: Human XM_006710710.3

PREDICTED: Homo sapiens solute carrier family 66 member 1 (SLC66A1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC66A1 (54896)
Length:
5109
CDS:
599..1141

Additional Resources:

NCBI RefSeq record:
XM_006710710.3
NBCI Gene record:
SLC66A1 (54896)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006710710.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143603 GAGAACAGTCTCAGCACAATT pLKO.1 3844 3UTR 100% 13.200 9.240 N SLC66A1 n/a
2 TRCN0000121655 GCCGAGATTTCAGGATAAGTT pLKO.1 4090 3UTR 100% 5.625 3.938 N SLC66A1 n/a
3 TRCN0000122689 GTGATGCTGACGCTGTACTTT pLKO.1 596 5UTR 100% 5.625 3.938 N SLC66A1 n/a
4 TRCN0000444798 CTCCATCTCCAGCGTGTTGTA pLKO_005 829 CDS 100% 4.950 3.465 N SLC66A1 n/a
5 TRCN0000424568 ATATGGGATGTGTTGGGTGAA pLKO_005 360 5UTR 100% 4.050 2.835 N SLC66A1 n/a
6 TRCN0000142629 CCGTTTCTTCATCCCATGAGA pLKO.1 4786 3UTR 100% 3.000 2.100 N SLC66A1 n/a
7 TRCN0000141716 GAAGCCGTTTCTTCATCCCAT pLKO.1 4782 3UTR 100% 2.640 1.848 N SLC66A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006710710.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03476 pDONR223 100% 79.6% 79.6% None 0_1ins138 n/a
2 ccsbBroad304_03476 pLX_304 0% 79.6% 79.6% V5 0_1ins138 n/a
3 TRCN0000466893 TCCCGTTGTTACCCCTGCTCGTAG pLX_317 47.9% 79.6% 79.6% V5 0_1ins138 n/a
Download CSV