Construct: ORF TRCN0000466893
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018235.1_s317c1
- Derived from:
- ccsbBroadEn_03476
- DNA Barcode:
- TCCCGTTGTTACCCCTGCTCGTAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SLC66A1 (54896)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466893
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54896 | SLC66A1 | solute carrier family 66 me... | NM_001040126.2 | 100% | 100% | |
| 2 | human | 54896 | SLC66A1 | solute carrier family 66 me... | NM_001287531.2 | 79.6% | 79.6% | 0_1ins138 |
| 3 | human | 54896 | SLC66A1 | solute carrier family 66 me... | XM_006710710.3 | 79.6% | 79.6% | 0_1ins138 |
| 4 | human | 54896 | SLC66A1 | solute carrier family 66 me... | XM_006710711.2 | 79.6% | 79.6% | 0_1ins138 |
| 5 | human | 54896 | SLC66A1 | solute carrier family 66 me... | NM_001040125.2 | 77.6% | 77.6% | 1_195del |
| 6 | human | 54896 | SLC66A1 | solute carrier family 66 me... | NM_017765.3 | 77.6% | 77.6% | 1_195del |
| 7 | human | 54896 | SLC66A1 | solute carrier family 66 me... | XM_005245916.2 | 77.6% | 77.6% | 1_195del |
| 8 | human | 54896 | SLC66A1 | solute carrier family 66 me... | XM_011541634.3 | 51.9% | 49.3% | (many diffs) |
| 9 | human | 54896 | SLC66A1 | solute carrier family 66 me... | XR_001737253.1 | 37.8% | 1_815del;1494_1792del | |
| 10 | human | 54896 | SLC66A1 | solute carrier family 66 me... | NR_109848.2 | 25.6% | 1_467del;1146_2639del | |
| 11 | human | 54896 | SLC66A1 | solute carrier family 66 me... | XR_001737254.1 | 10.6% | (many diffs) | |
| 12 | mouse | 212555 | Pqlc2 | PQ loop repeat containing 2 | NM_145384.2 | 66.2% | 67.2% | (many diffs) |
| 13 | mouse | 212555 | Pqlc2 | PQ loop repeat containing 2 | XM_011250220.2 | 66.2% | 67.2% | (many diffs) |
| 14 | mouse | 212555 | Pqlc2 | PQ loop repeat containing 2 | XM_011250221.2 | 66.2% | 67.2% | (many diffs) |
| 15 | mouse | 212555 | Pqlc2 | PQ loop repeat containing 2 | XM_011250222.2 | 66.2% | 67.2% | (many diffs) |
| 16 | mouse | 212555 | Pqlc2 | PQ loop repeat containing 2 | XM_017320095.1 | 66.2% | 67.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 744
- ORF length:
- 678
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ccaggcgctg tccctgtggt tcctcctggg ctggattggc ggagactcct 121 gcaacctcat cggctccttc cttgctgacc agctgcccct gcagacctac acggctgtgt 181 attatgtctt ggcagacctg gtgatgctga cgctgtactt ttactacaag ttcaggacgc 241 gcccctctct gttgtctgcc cccatcaact ccgtgctgtt gttcctcatg gggatggcgt 301 gcgccacacc gctgctgagt gctgctgggc ccgtggctgc ccctagggaa gccttccggg 361 ggcgggcgct cctgtccgtg gagtcgggca gcaagccctt cacccggcag gaagtcattG 421 GCTTCGTCAT CGGCTCCATC TCCAGCGTGT TGTACCTGCT TTCCCGGCTG CCTCAGATCC 481 GCACCAACTT CCTCCGGAAG TCCACCCAGG GGATCTCCTA CTCTCTGTTC GCGCTGGTGA 541 TGCTGGGGAA CACGCTGTAT GGGCTGAGCG TGCTGCTCAA AAACCCCGAG GAGGGCCAGA 601 GCGAGGGCAG CTACCTGCTG CACCACCTGC CCTGGCTTGT GGGCAGCCTG GGCGTGCTGC 661 TGCTCGACAC CATCATCTCC ATCCAGTTCC TGGTGTACAG GCGCAGCACC GCCGCCTCGG 721 AGCTTGAGCC CCTCCTCCCC AGCTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 781 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 841 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT CCCGTTGTTA 901 CCCCTGCTCG TAGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 961 att