Transcript: Human XM_006710725.4

PREDICTED: Homo sapiens transmembrane protein 39B (TMEM39B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM39B (55116)
Length:
3177
CDS:
147..1418

Additional Resources:

NCBI RefSeq record:
XM_006710725.4
NBCI Gene record:
TMEM39B (55116)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006710725.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242805 ATCCGTTTGGGATGTACATTC pLKO_005 733 CDS 100% 10.800 15.120 N TMEM39B n/a
2 TRCN0000242808 CTATCAGCTGTACTCCCTAAT pLKO_005 2807 3UTR 100% 10.800 15.120 N TMEM39B n/a
3 TRCN0000242809 TTGGGCAAGGCCTACTCATAC pLKO_005 2922 3UTR 100% 10.800 15.120 N TMEM39B n/a
4 TRCN0000167450 GAACACACATTACTATGACAA pLKO.1 1073 CDS 100% 4.950 6.930 N TMEM39B n/a
5 TRCN0000242807 ACAGCAAGAACGTCTACAAAG pLKO_005 1306 CDS 100% 10.800 7.560 N TMEM39B n/a
6 TRCN0000242806 TGAAGAACACACATTACTATG pLKO_005 1069 CDS 100% 10.800 7.560 N TMEM39B n/a
7 TRCN0000167888 CTTCAGCAACTACTATGCCTT pLKO.1 2873 3UTR 100% 2.640 1.848 N TMEM39B n/a
8 TRCN0000172550 GAAGCACAGCAAGAACGTCTA pLKO.1 1301 CDS 100% 4.050 2.430 N TMEM39B n/a
9 TRCN0000124006 GCCTACTATGTGGCCTTTGTA pLKO.1 1035 CDS 100% 5.625 3.938 N Tmem39b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006710725.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12160 pDONR223 100% 33% 31.5% None (many diffs) n/a
2 ccsbBroad304_12160 pLX_304 0% 33% 31.5% V5 (many diffs) n/a
3 TRCN0000480932 GTTCCCGCACCGGTAAAGCACCGC pLX_317 62.4% 33% 31.5% V5 (many diffs) n/a
Download CSV