Transcript: Human XM_006711242.4

PREDICTED: Homo sapiens flavin containing dimethylaniline monoxygenase 1 (FMO1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FMO1 (2326)
Length:
1988
CDS:
158..1414

Additional Resources:

NCBI RefSeq record:
XM_006711242.4
NBCI Gene record:
FMO1 (2326)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711242.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064463 CGAGTCCTGAAAGGTGTAAAT pLKO.1 1328 CDS 100% 13.200 18.480 N FMO1 n/a
2 TRCN0000064465 CCCAGAAGATTATCCAAACTA pLKO.1 379 CDS 100% 5.625 7.875 N FMO1 n/a
3 TRCN0000437116 AGCCAACCCTGGCCATTATTG pLKO_005 1245 CDS 100% 13.200 10.560 N FMO1 n/a
4 TRCN0000064466 CATGCAAATTACGGCTTAATA pLKO.1 953 CDS 100% 15.000 10.500 N FMO1 n/a
5 TRCN0000429929 TACTTTCATAGCCGGCAATAT pLKO_005 665 CDS 100% 13.200 9.240 N FMO1 n/a
6 TRCN0000064464 CCTATTGACATCATTGTCTTT pLKO.1 1118 CDS 100% 4.950 3.465 N FMO1 n/a
7 TRCN0000064467 CTGTGGAGATTCACCGAACAT pLKO.1 275 CDS 100% 4.950 3.465 N FMO1 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1967 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711242.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00581 pDONR223 100% 78.5% 78.5% None 1254_1255ins342 n/a
2 ccsbBroad304_00581 pLX_304 0% 78.5% 78.5% V5 1254_1255ins342 n/a
3 TRCN0000479381 CTAGAGCTACACCTGGAATCCAAT pLX_317 11.6% 78.5% 78.5% V5 1254_1255ins342 n/a
Download CSV