Transcript: Human XM_006711410.3

PREDICTED: Homo sapiens Ral GEF with PH domain and SH3 binding motif 2 (RALGPS2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RALGPS2 (55103)
Length:
2372
CDS:
270..2021

Additional Resources:

NCBI RefSeq record:
XM_006711410.3
NBCI Gene record:
RALGPS2 (55103)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711410.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416506 GCCATAGTTTGGGTTATAATT pLKO_005 1291 CDS 100% 15.000 21.000 N RALGPS2 n/a
2 TRCN0000420811 GGAATAGATCGTAGCTAATTT pLKO_005 2349 3UTR 100% 15.000 21.000 N RALGPS2 n/a
3 TRCN0000047284 CATTCCCTATTTAGGTATCTA pLKO.1 863 CDS 100% 5.625 7.875 N RALGPS2 n/a
4 TRCN0000047285 AGAAACTGTATGAGCTGAATA pLKO.1 655 CDS 100% 13.200 9.240 N RALGPS2 n/a
5 TRCN0000413161 GAGACTATATAAGTAGCTTAA pLKO_005 829 CDS 100% 10.800 7.560 N RALGPS2 n/a
6 TRCN0000423067 TGACAAGAGTGGCACGAAATG pLKO_005 1546 CDS 100% 10.800 7.560 N RALGPS2 n/a
7 TRCN0000047286 AGCAGTCTTGTGAATATGATA pLKO.1 997 CDS 100% 5.625 3.938 N RALGPS2 n/a
8 TRCN0000047287 GAAGAATATGCGGGTCAGATA pLKO.1 420 CDS 100% 4.950 3.465 N RALGPS2 n/a
9 TRCN0000047283 GCTTTCAAGTTGTGGATGGAA pLKO.1 485 CDS 100% 3.000 2.100 N RALGPS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711410.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03523 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03523 pLX_304 0% 100% 100% V5 n/a
Download CSV