Transcript: Human XM_006711506.3

PREDICTED: Homo sapiens toll like receptor 5 (TLR5), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TLR5 (7100)
Length:
4871
CDS:
241..2817

Additional Resources:

NCBI RefSeq record:
XM_006711506.3
NBCI Gene record:
TLR5 (7100)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711506.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430395 CACTTAGTGTCTTGGATATAA pLKO_005 1949 CDS 100% 15.000 21.000 N TLR5 n/a
2 TRCN0000431479 GATTATGGAATGTATCCTAAT pLKO_005 3098 3UTR 100% 10.800 15.120 N TLR5 n/a
3 TRCN0000056957 CCCTTCCACCAGGAGTATTTA pLKO.1 1787 CDS 100% 15.000 10.500 N TLR5 n/a
4 TRCN0000056956 CCTGGGAAGTAGTAAGATATA pLKO.1 543 CDS 100% 13.200 9.240 N TLR5 n/a
5 TRCN0000056955 CCTTGCCTACAACAAGATAAA pLKO.1 1194 CDS 100% 13.200 9.240 N TLR5 n/a
6 TRCN0000420439 CTGTATTGAAAGATGGTTATT pLKO_005 641 CDS 100% 13.200 9.240 N TLR5 n/a
7 TRCN0000435020 CCCTGAACTCACGAGTCTTTG pLKO_005 1145 CDS 100% 10.800 7.560 N TLR5 n/a
8 TRCN0000056954 CCTCCTGTAGTGGAGATCAAA pLKO.1 1622 CDS 100% 5.625 3.938 N TLR5 n/a
9 TRCN0000056953 GCAGGTGCTTATCTGACCTTA pLKO.1 2570 CDS 100% 4.950 3.465 N TLR5 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4123 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711506.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07075 pDONR223 100% 99.9% 100% None 981T>C;2523A>G n/a
2 ccsbBroad304_07075 pLX_304 0% 99.9% 100% V5 981T>C;2523A>G n/a
3 TRCN0000476982 GCACTGAGCGGCTTCCAGTCGAAC pLX_317 15.6% 99.9% 100% V5 981T>C;2523A>G n/a
Download CSV