Transcript: Human XM_006711734.3

PREDICTED: Homo sapiens synaptosome associated protein 47 (SNAP47), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNAP47 (116841)
Length:
2168
CDS:
308..1615

Additional Resources:

NCBI RefSeq record:
XM_006711734.3
NBCI Gene record:
SNAP47 (116841)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711734.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427896 TGACCAGTTGTGAACCCTTTG pLKO_005 948 CDS 100% 6.000 8.400 N SNAP47 n/a
2 TRCN0000431623 ACTTTGAGGGCATCCTATAAA pLKO_005 2013 3UTR 100% 15.000 10.500 N SNAP47 n/a
3 TRCN0000168051 CAGAACAGAGTCTCACGTTAA pLKO.1 1012 CDS 100% 10.800 7.560 N SNAP47 n/a
4 TRCN0000168154 CTTCAGCATCATCGAGCATTT pLKO.1 625 CDS 100% 10.800 7.560 N SNAP47 n/a
5 TRCN0000446705 GGCAGATACCCAGGAACTAAC pLKO_005 1444 CDS 100% 10.800 7.560 N SNAP47 n/a
6 TRCN0000425876 AGACATGGCCTATCGTTTGAT pLKO_005 1183 CDS 100% 5.625 3.938 N SNAP47 n/a
7 TRCN0000172490 CCTCTCCAGCATAGTTGAGAT pLKO.1 502 CDS 100% 4.950 3.465 N SNAP47 n/a
8 TRCN0000172842 GCCAAGTCGAAATGTGGTCTT pLKO.1 607 CDS 100% 4.050 2.835 N SNAP47 n/a
9 TRCN0000167217 CCTTCTTAGCTGTACTATAAA pLKO.1 1952 3UTR 100% 15.000 9.000 N SNAP47 n/a
10 TRCN0000442872 GGCAACCTTGACCATCGACAA pLKO_005 1564 CDS 100% 4.050 2.430 N SNAP47 n/a
11 TRCN0000069467 CCTTTGGGAAAGAAGGGATTT pLKO.1 963 CDS 100% 10.800 6.480 N Clcn4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711734.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09436 pDONR223 100% 93.5% 93.3% None 0_1ins88;2delT;1054C>T n/a
2 ccsbBroad304_09436 pLX_304 0% 93.5% 93.3% V5 0_1ins88;2delT;1054C>T n/a
3 TRCN0000473598 ACTGGTGGTAAAGCCCCCCTTTGT pLX_317 16.3% 93.5% 93.3% V5 0_1ins88;2delT;1054C>T n/a
4 ccsbBroadEn_14361 pDONR223 100% 50.8% 50.8% None 1_639del;1119C>T;1301T>A n/a
5 ccsbBroad304_14361 pLX_304 0% 50.8% 50.8% V5 1_639del;1119C>T;1301T>A n/a
6 TRCN0000466953 TAAAGTCTGCATATGCCAAGCTGG pLX_317 56.7% 50.8% 50.8% V5 1_639del;1119C>T;1301T>A n/a
Download CSV