Transcript: Human XM_006711817.4

PREDICTED: Homo sapiens WD repeat domain 26 (WDR26), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR26 (80232)
Length:
7030
CDS:
359..2341

Additional Resources:

NCBI RefSeq record:
XM_006711817.4
NBCI Gene record:
WDR26 (80232)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711817.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139717 CAAAGGGATCGGTGCCTATAT pLKO.1 1292 CDS 100% 13.200 18.480 N WDR26 n/a
2 TRCN0000339107 CAAAGGGATCGGTGCCTATAT pLKO_005 1292 CDS 100% 13.200 18.480 N Wdr26 n/a
3 TRCN0000143778 GCACTAAACTAGCAACAGGAT pLKO.1 1455 CDS 100% 2.640 3.696 N WDR26 n/a
4 TRCN0000122611 GCAGTTCTATCAGTGTGACTT pLKO.1 1759 CDS 100% 4.950 3.960 N WDR26 n/a
5 TRCN0000276350 GCAGTTCTATCAGTGTGACTT pLKO_005 1759 CDS 100% 4.950 3.960 N WDR26 n/a
6 TRCN0000176727 CCAAACATTTACACCTTGCTT pLKO.1 2487 3UTR 100% 3.000 2.400 N Wdr26 n/a
7 TRCN0000144564 GTGCCTATATCACAATACCAA pLKO.1 1303 CDS 100% 3.000 2.400 N WDR26 n/a
8 TRCN0000276293 ACCCATTGAACTCAGTATATA pLKO_005 2610 3UTR 100% 15.000 10.500 N WDR26 n/a
9 TRCN0000144116 CAGTGTGACTTAGATGGTAAT pLKO.1 1769 CDS 100% 10.800 7.560 N WDR26 n/a
10 TRCN0000144312 CCAGATGACAACTATCTTGTT pLKO.1 1586 CDS 100% 4.950 3.465 N WDR26 n/a
11 TRCN0000276294 CCAGATGACAACTATCTTGTT pLKO_005 1586 CDS 100% 4.950 3.465 N WDR26 n/a
12 TRCN0000138980 CCTCAGATGATGGCACTGTTA pLKO.1 2250 CDS 100% 4.950 3.465 N WDR26 n/a
13 TRCN0000276295 CCTCAGATGATGGCACTGTTA pLKO_005 2250 CDS 100% 4.950 3.465 N WDR26 n/a
14 TRCN0000143268 GAGGCCATAATGAAGACTTCA pLKO.1 2091 CDS 100% 4.950 3.465 N WDR26 n/a
15 TRCN0000198485 GCTTACCCATTGAACTCAGTA pLKO.1 2606 3UTR 100% 4.950 3.465 N Wdr26 n/a
16 TRCN0000177411 GCTTTGTTAAATGTAGCAACT pLKO.1 1976 CDS 100% 4.050 2.835 N Wdr26 n/a
17 TRCN0000339168 GCTTTGTTAAATGTAGCAACT pLKO_005 1976 CDS 100% 4.050 2.835 N Wdr26 n/a
18 TRCN0000339169 CCAAATCTTTCCGCCTTATTT pLKO_005 2810 3UTR 100% 15.000 9.000 N Wdr26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711817.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.