Transcript: Human XM_006712015.3

PREDICTED: Homo sapiens luteinizing hormone/choriogonadotropin receptor (LHCGR), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LHCGR (3973)
Length:
3049
CDS:
957..2126

Additional Resources:

NCBI RefSeq record:
XM_006712015.3
NBCI Gene record:
LHCGR (3973)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712015.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363161 GTCCTGATTTGGCTGATTAAT pLKO_005 1116 CDS 100% 15.000 10.500 N LHCGR n/a
2 TRCN0000363218 TCATTGTTACATGGCATAAAT pLKO_005 2311 3UTR 100% 15.000 10.500 N LHCGR n/a
3 TRCN0000363198 ACCAAGGGCCAGTACTATAAC pLKO_005 1290 CDS 100% 13.200 9.240 N LHCGR n/a
4 TRCN0000363193 CCACTCTCTCACAAGTCTATA pLKO_005 1588 CDS 100% 13.200 9.240 N LHCGR n/a
5 TRCN0000011703 GCTGAACTTTATAGAAGGAAA pLKO.1 1968 CDS 100% 4.950 3.465 N LHCGR n/a
6 TRCN0000011705 GCTGCGATTAAGACATGCCAT pLKO.1 1457 CDS 100% 2.640 1.848 N LHCGR n/a
7 TRCN0000011702 CCACAGAAAGTTCTATCTGTT pLKO.1 2714 3UTR 100% 0.495 0.347 N LHCGR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712015.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489581 GGCTGGTCTGCCGTAAGAGATTTA pLX_317 16.9% 55.4% 54.7% V5 (many diffs) n/a
2 TRCN0000488193 TACACGCAAGGTTGAGCTTGGCAA pLX_317 16% 55.4% 54.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV