Transcript: Human XM_006712031.4

PREDICTED: Homo sapiens ATPase family AAA domain containing 2B (ATAD2B), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATAD2B (54454)
Length:
5392
CDS:
297..3500

Additional Resources:

NCBI RefSeq record:
XM_006712031.4
NBCI Gene record:
ATAD2B (54454)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712031.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021130 CGCTGTTTGATATTCATAGAT pLKO.1 1270 CDS 100% 5.625 7.875 N ATAD2B n/a
2 TRCN0000336606 GCTAAAGGAAATGGTAGTATT pLKO_005 1571 CDS 100% 13.200 9.240 N ATAD2B n/a
3 TRCN0000328862 GTGGATTGAGCCATCATATTC pLKO_005 1546 CDS 100% 13.200 9.240 N Atad2b n/a
4 TRCN0000336621 GTGGATTGAGCCATCATATTC pLKO_005 1546 CDS 100% 13.200 9.240 N ATAD2B n/a
5 TRCN0000336663 GTTGAAGTTGATGGTAGTTTA pLKO_005 516 CDS 100% 13.200 9.240 N ATAD2B n/a
6 TRCN0000336605 TCTTATGGATGGATTAGATAA pLKO_005 1931 CDS 100% 13.200 9.240 N ATAD2B n/a
7 TRCN0000021131 CCTCATCTGTAGCAATGCTTT pLKO.1 3422 CDS 100% 4.950 3.465 N ATAD2B n/a
8 TRCN0000197755 GAATGTGGACAGATACAGAAT pLKO.1 949 CDS 100% 4.950 3.465 N Atad2b n/a
9 TRCN0000021129 GCCATCATATTCATGCGCTAA pLKO.1 1555 CDS 100% 4.050 2.835 N ATAD2B n/a
10 TRCN0000328828 CTTATGGATGGATTAGATAAT pLKO_005 1932 CDS 100% 13.200 7.920 N Atad2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712031.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.