Transcript: Human XM_006712720.4

PREDICTED: Homo sapiens tissue factor pathway inhibitor (TFPI), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TFPI (7035)
Length:
1166
CDS:
114..1028

Additional Resources:

NCBI RefSeq record:
XM_006712720.4
NBCI Gene record:
TFPI (7035)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712720.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073584 CGAGGTTATATTACCAGGTAT pLKO.1 516 CDS 100% 4.950 6.930 N TFPI n/a
2 TRCN0000291639 CGAGGTTATATTACCAGGTAT pLKO_005 516 CDS 100% 4.950 6.930 N TFPI n/a
3 TRCN0000073587 GCCCATTTAAGTACAGTGGAT pLKO.1 841 CDS 100% 2.640 3.696 N TFPI n/a
4 TRCN0000073585 CCTGGGCAATATGAACAATTT pLKO.1 587 CDS 100% 13.200 9.240 N TFPI n/a
5 TRCN0000333214 CCTGGGCAATATGAACAATTT pLKO_005 587 CDS 100% 13.200 9.240 N TFPI n/a
6 TRCN0000073586 TCCTGGAATATGTCGAGGTTA pLKO.1 503 CDS 100% 4.950 3.465 N TFPI n/a
7 TRCN0000291638 TCCTGGAATATGTCGAGGTTA pLKO_005 503 CDS 100% 4.950 3.465 N TFPI n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712720.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07053 pDONR223 100% 76.5% 63.3% None (many diffs) n/a
2 ccsbBroad304_07053 pLX_304 0% 76.5% 63.3% V5 (many diffs) n/a
3 TRCN0000471352 GCCTAATAACGGGATTTTCCATGG pLX_317 66.1% 76.5% 63.3% V5 (many diffs) n/a
Download CSV