Transcript: Human XM_006713478.4

PREDICTED: Homo sapiens insulin like growth factor 2 mRNA binding protein 2 (IGF2BP2), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IGF2BP2 (10644)
Length:
2949
CDS:
267..1169

Additional Resources:

NCBI RefSeq record:
XM_006713478.4
NBCI Gene record:
IGF2BP2 (10644)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713478.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255463 GGTGCCTGCAGCGGTAATATA pLKO_005 1619 3UTR 100% 15.000 21.000 N IGF2BP2 n/a
2 TRCN0000255468 GTTGGCCCAGGGCGTTAAATT pLKO_005 2415 3UTR 100% 15.000 21.000 N IGF2BP2 n/a
3 TRCN0000148565 CGGATCTTTGGGAAACTGAAA pLKO.1 840 CDS 100% 4.950 3.960 N IGF2BP2 n/a
4 TRCN0000255461 AGCGCAAGATCAGGGAAATTG pLKO_005 1084 CDS 100% 13.200 9.240 N IGF2BP2 n/a
5 TRCN0000146301 CAGTGCTGAGATAGAGATTAT pLKO.1 503 CDS 100% 13.200 9.240 N IGF2BP2 n/a
6 TRCN0000255467 TTCCCGCATCATCACTCTTAT pLKO_005 621 CDS 100% 13.200 9.240 N IGF2BP2 n/a
7 TRCN0000255462 AGTGAAGCTGGAAGCGCATAT pLKO_005 890 CDS 100% 10.800 7.560 N IGF2BP2 n/a
8 TRCN0000255465 ATCAAACAGCTGGCGAGATTC pLKO_005 717 CDS 100% 10.800 7.560 N IGF2BP2 n/a
9 TRCN0000255464 CTGAAGCATGCCGCATGATTC pLKO_005 253 5UTR 100% 10.800 7.560 N IGF2BP2 n/a
10 TRCN0000149002 GCATATACAACCCGGAAAGAA pLKO.1 448 CDS 100% 5.625 3.938 N IGF2BP2 n/a
11 TRCN0000148718 CTTAACCAGTGCAGAAGTCAT pLKO.1 980 CDS 100% 4.950 3.465 N IGF2BP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713478.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10208 pDONR223 100% 50.1% 50.1% None 0_1ins765;303_304ins129 n/a
2 ccsbBroad304_10208 pLX_304 0% 50.1% 50.1% V5 0_1ins765;303_304ins129 n/a
3 TRCN0000469479 CACTGCACGGTTCACGCTGAGAAA pLX_317 22.8% 50.1% 50.1% V5 0_1ins765;303_304ins129 n/a
Download CSV