Transcript: Human XM_006713529.4

PREDICTED: Homo sapiens lipase H (LIPH), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LIPH (200879)
Length:
3142
CDS:
132..1397

Additional Resources:

NCBI RefSeq record:
XM_006713529.4
NBCI Gene record:
LIPH (200879)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713529.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372786 GTGGTTGGTACGGGACTAAAT pLKO_005 231 CDS 100% 13.200 18.480 N LIPH n/a
2 TRCN0000372847 TAATTGGAAAGACCATCTAAG pLKO_005 941 CDS 100% 10.800 15.120 N LIPH n/a
3 TRCN0000372848 TATACCCATGCCTCTAGTAAG pLKO_005 480 CDS 100% 10.800 15.120 N LIPH n/a
4 TRCN0000050650 GCCCACATATCTGGGTTTGTT pLKO.1 600 CDS 100% 5.625 3.938 N LIPH n/a
5 TRCN0000050648 GCGTCCTATGGATGTCACATT pLKO.1 1523 3UTR 100% 4.950 3.465 N LIPH n/a
6 TRCN0000050649 CCAGGATTATAGGAATGGCAA pLKO.1 860 CDS 100% 2.640 1.848 N LIPH n/a
7 TRCN0000050651 CGAATGAAGTTAAGGTCCCTT pLKO.1 1275 CDS 100% 2.640 1.848 N LIPH n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3054 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3054 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713529.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05194 pDONR223 100% 93.3% 93.3% None 627_628ins90 n/a
2 ccsbBroad304_05194 pLX_304 0% 93.3% 93.3% V5 627_628ins90 n/a
3 TRCN0000472001 CCTTGAAAAGACGCTACAAAGCGT pLX_317 31.4% 93.3% 93.3% V5 627_628ins90 n/a
Download CSV