Construct: ORF TRCN0000472001
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018165.1_s317c1
- Derived from:
- ccsbBroadEn_05194
- DNA Barcode:
- CCTTGAAAAGACGCTACAAAGCGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LIPH (200879)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472001
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 200879 | LIPH | lipase H | NM_139248.3 | 100% | 100% | |
2 | human | 200879 | LIPH | lipase H | XM_006713529.4 | 93.3% | 93.3% | 627_628ins90 |
3 | human | 200879 | LIPH | lipase H | XM_017005852.2 | 92.4% | 92.4% | 525_526ins102 |
4 | human | 200879 | LIPH | lipase H | XM_011512530.3 | 90.4% | 90.4% | 0_1ins129 |
5 | human | 200879 | LIPH | lipase H | XM_011512531.3 | 90.4% | 90.4% | 0_1ins129 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1419
- ORF length:
- 1353
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt gagattctac ttattcatca gtttgttgtg cttgtcaaga tcagacgcag 121 aagaaacatg tccttcattc accaggctga gctttcacag tgcagtggtt ggtacgggac 181 taaatgtgag gctgatgctc tacacaagga aaaacctgac ctgcgcacaa accatcaact 241 cctcagcttt tgggaacttg aatgtgacca agaaaaccac cttcattgtc catggattca 301 ggccaacagg ctcccctcct gtttggatgg atgacttagt aaagggtttg ctctctgttg 361 aagacatgaa cgtagttgtt gttgattgga atcgaggagc tacaacttta atatataccc 421 atgcctctag taagaccaga aaagtagcca tggtcttgaa ggaatttatt gaccagatgt 481 tggcagaagg agcttctctt gatgacattt acatgatcgg agtaagtcta ggagcccaca 541 tatctgggtt tgttggagag atgtacgatg gatggctggg gagaattaca ggcctcgacc 601 ctgcaggccc tttattcaac gggaaacctc accaagacag attagatccc agtgatgcgc 661 agtttgttga tgtcatccat tccgacactg atgcactggg ctacaaggag ccattaggaa 721 acatagactt ctacccaaat ggaggattgg atcaacctgg ctgccccaaa acaatattgg 781 gaggatttca gtattttaaa tgtgaccacc agaggtctgt atacctgtac ctgtcttccc 841 tgagagagag ctgcaccatc actgcgtatc cctgtgactc ctaccaggat tataggaatg 901 gcaagtgtgt cagctgcggc acgtcacaaa aagagtcctg tccccttctg ggctattatg 961 ctgataattg gaaagaccat ctaaggggga aagatccTCC AATGACGAAG GCATTCTTTG 1021 ACACAGCTGA GGAGAGCCCA TTCTGCATGT ATCATTACTT TGTGGATATT ATAACATGGA 1081 ACAAGAATGT AAGAAGAGGG GACATTACCA TCAAATTGAG AGACAAAGCT GGAAACACCA 1141 CAGAATCCAA AATCAATCAT GAACCCACCA CATTTCAGAA ATATCACCAA GTGAGTCTAC 1201 TTGCAAGATT TAATCAAGAT CTGGATAAAG TGGCTGCAAT TTCCTTGATG TTCTCTACAG 1261 GATCTCTAAT AGGCCCAAGG TACAAGCTCA GGATTCTCCG AATGAAGTTA AGGTCCCTTG 1321 CCCATCCGGA GAGGCCTCAG CTGTGTCGGT ATGATCTTGT CCTGATGGAA AACGTTGAAA 1381 CAGTCTTCCA ACCTATTCTT TGCCCAGAGT TGCAGTTGTA CCCAACTTTC TTGTACAAAG 1441 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1501 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1561 ACGACCTTGA AAAGACGCTA CAAAGCGTAC GCGTTAAGTC gacaatcaac ctctggatta 1621 caaaatttgt gaaagatt