Transcript: Human XM_006713566.4

PREDICTED: Homo sapiens armadillo repeat containing 8 (ARMC8), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARMC8 (25852)
Length:
4702
CDS:
324..2219

Additional Resources:

NCBI RefSeq record:
XM_006713566.4
NBCI Gene record:
ARMC8 (25852)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713566.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166876 CGGACAGATGATAACTGTATT pLKO.1 1005 CDS 100% 13.200 9.240 N ARMC8 n/a
2 TRCN0000319086 CGGACAGATGATAACTGTATT pLKO_005 1005 CDS 100% 13.200 9.240 N ARMC8 n/a
3 TRCN0000167599 GAGAATTGTTACCACAGATTT pLKO.1 895 CDS 100% 13.200 9.240 N ARMC8 n/a
4 TRCN0000319013 GAGAATTGTTACCACAGATTT pLKO_005 895 CDS 100% 13.200 9.240 N ARMC8 n/a
5 TRCN0000168419 GTGAAGATGTTACAGAGGGAT pLKO.1 918 CDS 100% 2.640 1.848 N ARMC8 n/a
6 TRCN0000319014 GTGAAGATGTTACAGAGGGAT pLKO_005 918 CDS 100% 2.640 1.848 N ARMC8 n/a
7 TRCN0000167668 GCACTGAAATGTTTCTCAGTT pLKO.1 819 CDS 100% 0.495 0.347 N ARMC8 n/a
8 TRCN0000319084 GCACTGAAATGTTTCTCAGTT pLKO_005 819 CDS 100% 0.495 0.347 N ARMC8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713566.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02872 pDONR223 100% 53% 51.7% None (many diffs) n/a
2 ccsbBroad304_02872 pLX_304 0% 53% 51.7% V5 (many diffs) n/a
3 TRCN0000474364 GCAATCAGATGATACCTCGAAGCC pLX_317 45.2% 53% 51.7% V5 (many diffs) n/a
Download CSV