Transcript: Human XM_006714037.4

PREDICTED: Homo sapiens cysteine rich hydrophobic domain 2 (CHIC2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHIC2 (26511)
Length:
14564
CDS:
391..804

Additional Resources:

NCBI RefSeq record:
XM_006714037.4
NBCI Gene record:
CHIC2 (26511)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006714037.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312636 TCCGGTCACGTCACCGTATTT pLKO_005 493 CDS 100% 13.200 18.480 N CHIC2 n/a
2 TRCN0000118911 GAAACGAATAACATGATGGAA pLKO.1 730 CDS 100% 3.000 2.400 N CHIC2 n/a
3 TRCN0000176285 GTTATACCACAAGCTGTGCTT pLKO.1 681 CDS 100% 2.640 2.112 N Chic2 n/a
4 TRCN0000350150 GTTATACCACAAGCTGTGCTT pLKO_005 681 CDS 100% 2.640 2.112 N Chic2 n/a
5 TRCN0000312691 AGATCGATTGAGAAGTTATTA pLKO_005 643 CDS 100% 15.000 10.500 N CHIC2 n/a
6 TRCN0000369847 AGTAGCTCCTGAAGAATTTAA pLKO_005 564 CDS 100% 15.000 10.500 N CHIC2 n/a
7 TRCN0000369920 CAGAGTTAACAGTTGTCTTAA pLKO_005 597 CDS 100% 13.200 9.240 N CHIC2 n/a
8 TRCN0000312637 TTTCGACCAGATTAGCATTTA pLKO_005 790 CDS 100% 13.200 9.240 N CHIC2 n/a
9 TRCN0000174891 GAATATGTCATCCTCATAGAA pLKO.1 748 CDS 100% 5.625 3.938 N Chic2 n/a
10 TRCN0000320180 GAATATGTCATCCTCATAGAA pLKO_005 748 CDS 100% 5.625 3.938 N Chic2 n/a
11 TRCN0000174918 GTATTTGGACTGAGCAACAAA pLKO.1 508 CDS 100% 5.625 3.938 N Chic2 n/a
12 TRCN0000320178 GTATTTGGACTGAGCAACAAA pLKO_005 508 CDS 100% 5.625 3.938 N Chic2 n/a
13 TRCN0000118907 CGCATGTTCTAAGTGTGCATT pLKO.1 952 3UTR 100% 4.950 3.465 N CHIC2 n/a
14 TRCN0000327696 CGCATGTTCTAAGTGTGCATT pLKO_005 952 3UTR 100% 4.950 3.465 N CHIC2 n/a
15 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 9751 3UTR 100% 4.050 2.025 Y LOC441087 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006714037.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491711 ACGCAACTAACCGCTGTTCTTTCG pLX_317 68.1% 83% 83% V5 246_247ins84 n/a
2 ccsbBroadEn_08021 pDONR223 100% 82.8% 82.4% None 246_247ins84;404G>C n/a
3 ccsbBroad304_08021 pLX_304 0% 82.8% 82.4% V5 246_247ins84;404G>C n/a
Download CSV