Transcript: Human XM_006714111.4

PREDICTED: Homo sapiens protein phosphatase, Mg2+/Mn2+ dependent 1K (PPM1K), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPM1K (152926)
Length:
6643
CDS:
547..1665

Additional Resources:

NCBI RefSeq record:
XM_006714111.4
NBCI Gene record:
PPM1K (152926)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006714111.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363116 CCCTATTGCGAGATGGTATTG pLKO_005 1124 CDS 100% 10.800 15.120 N PPM1K n/a
2 TRCN0000002728 ACTCACTAGATCAGCGCACAA pLKO.1 1749 3UTR 100% 4.050 5.670 N PPM1K n/a
3 TRCN0000002729 CGAGATGGTATTGAACTGGTT pLKO.1 1132 CDS 100% 2.640 3.696 N PPM1K n/a
4 TRCN0000363120 CAGCGCACAAGTCAGTGTAAA pLKO_005 1760 3UTR 100% 13.200 9.240 N PPM1K n/a
5 TRCN0000356279 CCTGAAACTAAGAGGATTAAG pLKO_005 1378 CDS 100% 13.200 9.240 N PPM1K n/a
6 TRCN0000363085 TGAAGCTACTGTGAGTCTTTA pLKO_005 1861 3UTR 100% 13.200 9.240 N PPM1K n/a
7 TRCN0000002727 CCATTGACCATACTCCAGAAA pLKO.1 1214 CDS 100% 4.950 3.465 N PPM1K n/a
8 TRCN0000002726 GTATTGGAGATTTGGACCTTA pLKO.1 1334 CDS 100% 4.950 3.465 N PPM1K n/a
9 TRCN0000002725 GAAAGAGAATGAAGATCGGTT pLKO.1 858 CDS 100% 2.640 1.848 N PPM1K n/a
10 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2337 3UTR 100% 4.950 2.475 Y ORAI2 n/a
11 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 5378 3UTR 100% 4.950 2.475 Y LOC387873 n/a
12 TRCN0000140536 GCCAACATGGTGAAACCTCAT pLKO.1 4000 3UTR 100% 4.050 2.025 Y TLCD4 n/a
13 TRCN0000040213 CCTCCCAAATTGCTGGGATTA pLKO.1 5867 3UTR 100% 1.080 0.540 Y IGF1 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2260 3UTR 100% 13.200 6.600 Y LIAS n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5415 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2334 3UTR 100% 4.950 2.475 Y LOC339059 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5415 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006714111.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09692 pDONR223 100% 99.9% 99.7% None 282T>G n/a
2 ccsbBroad304_09692 pLX_304 0% 99.9% 99.7% V5 282T>G n/a
3 TRCN0000474353 TCCCATACCAACACTCTCAAGCCC pLX_317 48% 99.9% 99.7% V5 282T>G n/a
4 TRCN0000488473 GAGGATGCTTGGGGATCGGTTCAA pLX_317 28.3% 99.9% 99.7% V5 (not translated due to prior stop codon) 282T>G n/a
Download CSV