Transcript: Human XM_006714234.4

PREDICTED: Homo sapiens myozenin 2 (MYOZ2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYOZ2 (51778)
Length:
1460
CDS:
166..753

Additional Resources:

NCBI RefSeq record:
XM_006714234.4
NBCI Gene record:
MYOZ2 (51778)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006714234.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433790 GCCTGATTACAGGAGCTTTAA pLKO_005 702 CDS 100% 13.200 9.240 N MYOZ2 n/a
2 TRCN0000152923 CCAGTATCAATCTAGAGCACA pLKO.1 384 CDS 100% 2.640 1.848 N MYOZ2 n/a
3 TRCN0000155144 GCCAGGCTATTTAAGATGCGT pLKO.1 328 CDS 100% 0.750 0.525 N MYOZ2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006714234.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03383 pDONR223 100% 72.9% 71.9% None (many diffs) n/a
2 ccsbBroad304_03383 pLX_304 0% 72.9% 71.9% V5 (many diffs) n/a
3 TRCN0000491345 TACATGACAATGTCCTTATCGTGT pLX_317 35% 72.9% 71.9% V5 (many diffs) n/a
4 ccsbBroadEn_15857 pDONR223 0% 72.7% 71.9% None (many diffs) n/a
5 ccsbBroad304_15857 pLX_304 0% 72.7% 71.9% V5 (many diffs) n/a
6 TRCN0000480033 GAATAAAAGGAACACGTGTTTGCG pLX_317 45.4% 72.7% 71.9% V5 (many diffs) n/a
Download CSV