Transcript: Human XM_006714526.4

PREDICTED: Homo sapiens kinesin family member 3A (KIF3A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIF3A (11127)
Length:
3201
CDS:
145..2319

Additional Resources:

NCBI RefSeq record:
XM_006714526.4
NBCI Gene record:
KIF3A (11127)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006714526.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427918 TTCGACTTCAGATGCTTATTA pLKO_005 1979 CDS 100% 15.000 21.000 N KIF3A n/a
2 TRCN0000116816 CGGGATTATCAGGAAATGATT pLKO.1 2017 CDS 100% 5.625 4.500 N KIF3A n/a
3 TRCN0000419360 AGCAAGAACGCTTGGATATTG pLKO_005 1790 CDS 100% 13.200 9.240 N KIF3A n/a
4 TRCN0000427122 CACAAAGGTTAGAGGTTAAAG pLKO_005 641 CDS 100% 13.200 9.240 N KIF3A n/a
5 TRCN0000116814 CGTCAGTCTTTGATGAAACTA pLKO.1 2206 CDS 100% 5.625 3.938 N KIF3A n/a
6 TRCN0000116815 GCAACTAATATGAACGAACAT pLKO.1 772 CDS 100% 4.950 3.465 N KIF3A n/a
7 TRCN0000339512 ATATTGGGCCAGCAGATTATA pLKO_005 1106 CDS 100% 15.000 10.500 N Kif3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006714526.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14061 pDONR223 100% 94.7% 93.6% None (many diffs) n/a
2 ccsbBroad304_14061 pLX_304 0% 94.7% 93.6% V5 (many diffs) n/a
3 TRCN0000478731 ATGAAATGAAAACGAACCGCTTCC pLX_317 14.9% 94.3% 93.6% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV