Transcript: Human XM_006715090.2

PREDICTED: Homo sapiens interferon regulatory factor 4 (IRF4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IRF4 (3662)
Length:
5203
CDS:
114..1361

Additional Resources:

NCBI RefSeq record:
XM_006715090.2
NBCI Gene record:
IRF4 (3662)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715090.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014764 GCCATTCCTCTATTCAAGAAT pLKO.1 1339 CDS 100% 5.625 7.875 N IRF4 n/a
2 TRCN0000014765 TGCGCTTTGAACAAGAGCAAT pLKO.1 408 CDS 100% 4.950 6.930 N IRF4 n/a
3 TRCN0000014763 GCCCAAATTCTCCTCTCTAAA pLKO.1 3121 3UTR 100% 13.200 10.560 N IRF4 n/a
4 TRCN0000433892 TTTACTGAAATGCGCTCTTTA pLKO_005 1830 3UTR 100% 13.200 9.240 N IRF4 n/a
5 TRCN0000429523 CTTTAGTGAAAGCGTCCAATT pLKO_005 1598 3UTR 100% 10.800 7.560 N IRF4 n/a
6 TRCN0000014766 CCAGCAGGTTCACAACTACAT pLKO.1 602 CDS 100% 4.950 3.465 N IRF4 n/a
7 TRCN0000014767 GCTCTTTGACACACAGCAGTT pLKO.1 1076 CDS 100% 4.050 2.835 N IRF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715090.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06459 pDONR223 100% 91.9% 92% None 421C>T;636_637ins108 n/a
2 TRCN0000470342 CTTGCGCACAGCTTTTTTACGTGA pLX_317 30.4% 91.9% 92% V5 421C>T;636_637ins108 n/a
3 ccsbBroad304_06459 pLX_304 46.7% 91.8% 51.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV