Transcript: Human XM_006715103.3

PREDICTED: Homo sapiens solute carrier family 35 member B3 (SLC35B3), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC35B3 (51000)
Length:
1908
CDS:
309..1427

Additional Resources:

NCBI RefSeq record:
XM_006715103.3
NBCI Gene record:
SLC35B3 (51000)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715103.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427290 TGACGGGTGTGGTGCTTATTT pLKO_005 991 CDS 100% 15.000 21.000 N SLC35B3 n/a
2 TRCN0000044533 CCTATGGTTATGCGTTCCTTT pLKO.1 1108 CDS 100% 4.950 6.930 N SLC35B3 n/a
3 TRCN0000412952 ACCATTGTACTTTCGTTTATA pLKO_005 1230 CDS 100% 15.000 12.000 N SLC35B3 n/a
4 TRCN0000044535 GCATGAATCTCAGCAAGTTTA pLKO.1 520 CDS 100% 13.200 10.560 N SLC35B3 n/a
5 TRCN0000432182 ATTCAAGGAAAGCGTTATAAT pLKO_005 882 CDS 100% 15.000 10.500 N SLC35B3 n/a
6 TRCN0000432935 CAAGACTAATTGGCTATAATT pLKO_005 1722 3UTR 100% 15.000 10.500 N SLC35B3 n/a
7 TRCN0000044534 CCATCACTGTATGATTTGATA pLKO.1 1356 CDS 100% 5.625 3.938 N SLC35B3 n/a
8 TRCN0000044537 AGAACATAACAGTCCAGGAAA pLKO.1 346 CDS 100% 4.950 3.465 N SLC35B3 n/a
9 TRCN0000069309 CCTGTTATGCTAGGAGGAGTT pLKO.1 858 CDS 100% 4.050 2.835 N Slc35b3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715103.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08193 pDONR223 100% 91.7% 91.5% None (many diffs) n/a
2 ccsbBroad304_08193 pLX_304 0% 91.7% 91.5% V5 (many diffs) n/a
3 TRCN0000472317 GCTCAGACAAGGTAGCATAACGTT pLX_317 39.9% 91.7% 91.5% V5 (many diffs) n/a
Download CSV