Transcript: Human XM_006715175.2

PREDICTED: Homo sapiens transcription factor AP-2 alpha (TFAP2A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TFAP2A (7020)
Length:
3282
CDS:
94..1542

Additional Resources:

NCBI RefSeq record:
XM_006715175.2
NBCI Gene record:
TFAP2A (7020)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715175.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281947 CGTCTCCGCCATCCCTATTAA pLKO_005 795 CDS 100% 15.000 21.000 N TFAP2A n/a
2 TRCN0000004923 CCGGGTATTAACATCCCAGAT pLKO.1 721 CDS 100% 4.050 5.670 N TFAP2A n/a
3 TRCN0000004925 CCCAGATCAAACTGTAATTAA pLKO.1 735 CDS 100% 15.000 10.500 N TFAP2A n/a
4 TRCN0000272665 CCCAGATCAAACTGTAATTAA pLKO_005 735 CDS 100% 15.000 10.500 N TFAP2A n/a
5 TRCN0000272680 TCAGATTGTAGCCATACTTAA pLKO_005 2011 3UTR 100% 13.200 9.240 N TFAP2A n/a
6 TRCN0000004926 CCAATGAGCAAGTGACAAGAA pLKO.1 1211 CDS 100% 4.950 3.465 N TFAP2A n/a
7 TRCN0000272721 CCAATGAGCAAGTGACAAGAA pLKO_005 1211 CDS 100% 4.950 3.465 N TFAP2A n/a
8 TRCN0000004924 GCTGAATTTCTCAACCGACAA pLKO.1 1180 CDS 100% 4.050 2.835 N TFAP2A n/a
9 TRCN0000272718 GCTGAATTTCTCAACCGACAA pLKO_005 1180 CDS 100% 4.050 2.835 N TFAP2A n/a
10 TRCN0000004922 GCTCCGGGATCAGCAACCCTT pLKO.1 1613 3UTR 100% 0.000 0.000 N TFAP2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715175.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07050 pDONR223 100% 87.2% 87.2% None (many diffs) n/a
2 ccsbBroad304_07050 pLX_304 0% 87.2% 87.2% V5 (many diffs) n/a
3 TRCN0000481607 GAGGAAGGTATGTCTCAAGAGCCT pLX_317 37.3% 87.2% 87.2% V5 (many diffs) n/a
Download CSV