Transcript: Human XM_006715235.2

PREDICTED: Homo sapiens potassium two pore domain channel subfamily K member 5 (KCNK5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNK5 (8645)
Length:
3046
CDS:
174..1127

Additional Resources:

NCBI RefSeq record:
XM_006715235.2
NBCI Gene record:
KCNK5 (8645)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715235.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434137 GTATTACTGAGCTCGGCATTT pLKO_005 1519 3UTR 100% 10.800 15.120 N KCNK5 n/a
2 TRCN0000440495 GGTGATCCCACCCTTCGTATT pLKO_005 152 5UTR 100% 10.800 7.560 N KCNK5 n/a
3 TRCN0000044916 CCTTACGAACAGCTGATGAAT pLKO.1 1071 CDS 100% 5.625 3.938 N KCNK5 n/a
4 TRCN0000044917 GTCAACATCTTCAGCTTTCTT pLKO.1 489 CDS 100% 5.625 3.938 N KCNK5 n/a
5 TRCN0000044914 GCTGATGAATGAGTACAACAA pLKO.1 1082 CDS 100% 4.950 3.465 N KCNK5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715235.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01980 pDONR223 100% 63.5% 63.5% None 0_1ins546 n/a
2 ccsbBroad304_01980 pLX_304 0% 63.5% 63.5% V5 0_1ins546 n/a
3 TRCN0000477827 CTCACCGCCTCGTGATCGCTTCTG pLX_317 26% 63.5% 63.5% V5 0_1ins546 n/a
Download CSV