Transcript: Human XM_006715378.3

PREDICTED: Homo sapiens 5'-nucleotidase domain containing 1 (NT5DC1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NT5DC1 (221294)
Length:
1710
CDS:
99..1049

Additional Resources:

NCBI RefSeq record:
XM_006715378.3
NBCI Gene record:
NT5DC1 (221294)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715378.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115885 CCCGCTCATTTATAATAGCTT pLKO.1 188 CDS 100% 3.000 4.200 N NT5DC1 n/a
2 TRCN0000292074 CCCGCTCATTTATAATAGCTT pLKO_005 188 CDS 100% 3.000 4.200 N NT5DC1 n/a
3 TRCN0000115883 CCGCTCAGGAAAGTATTACTT pLKO.1 455 CDS 100% 5.625 4.500 N NT5DC1 n/a
4 TRCN0000307955 CCGCTCAGGAAAGTATTACTT pLKO_005 455 CDS 100% 5.625 4.500 N NT5DC1 n/a
5 TRCN0000115884 CCTGGTTTCTTCTCCCACTTA pLKO.1 852 CDS 100% 4.950 3.465 N NT5DC1 n/a
6 TRCN0000292076 CCTGGTTTCTTCTCCCACTTA pLKO_005 852 CDS 100% 4.950 3.465 N NT5DC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715378.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13423 pDONR223 100% 30.7% 30.1% None (many diffs) n/a
2 ccsbBroad304_13423 pLX_304 0% 30.7% 30.1% V5 (many diffs) n/a
3 TRCN0000470307 TCCCTAACAATTGTCGTAGCGTCG pLX_317 53.3% 30.7% 30.1% V5 (many diffs) n/a
Download CSV