Transcript: Human XM_006715562.4

PREDICTED: Homo sapiens vasoactive intestinal peptide (VIP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VIP (7432)
Length:
1582
CDS:
174..683

Additional Resources:

NCBI RefSeq record:
XM_006715562.4
NBCI Gene record:
VIP (7432)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715562.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078056 CCAGTCAAACGTCACTCAGAT pLKO.1 534 CDS 100% 4.950 6.930 N VIP n/a
2 TRCN0000078054 CCTATTATGATGTATCCAGAA pLKO.1 385 CDS 100% 4.050 5.670 N VIP n/a
3 TRCN0000373852 TGCTAGGTTAATTCCAATTAT pLKO_005 991 3UTR 100% 15.000 12.000 N VIP n/a
4 TRCN0000373934 ATAGAGTGTACTTAACTATTC pLKO_005 1063 3UTR 100% 10.800 7.560 N VIP n/a
5 TRCN0000078055 CTGACAACTATACCCGCCTTA pLKO.1 565 CDS 100% 4.050 2.835 N VIP n/a
6 TRCN0000078053 GCTGTGTTAAATAAACCTCAA pLKO.1 1140 3UTR 100% 4.050 2.835 N VIP n/a
7 TRCN0000078057 CCCGACTTTCCAGAAGAGTTA pLKO.1 654 CDS 100% 4.950 2.970 N VIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715562.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488214 CAGCTGTCGACTTGTGAAGATCCG pLX_317 57.6% 99.4% 99.4% V5 (not translated due to prior stop codon) 465_466insAGC n/a
2 ccsbBroadEn_01772 pDONR223 100% 98.8% 98.8% None 334_336delAGC;465_466insAGC n/a
3 ccsbBroad304_01772 pLX_304 0% 98.8% 98.8% V5 334_336delAGC;465_466insAGC n/a
4 TRCN0000467817 CGAAGACCTACAAATAAACATGTC pLX_317 70.5% 98.8% 98.8% V5 334_336delAGC;465_466insAGC n/a
Download CSV