Transcript: Human XM_006715867.4

PREDICTED: Homo sapiens zinc finger protein 800 (ZNF800), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF800 (168850)
Length:
7964
CDS:
798..2978

Additional Resources:

NCBI RefSeq record:
XM_006715867.4
NBCI Gene record:
ZNF800 (168850)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715867.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424987 GTGGACAAACGAGAATATATT pLKO_005 1167 CDS 100% 15.000 21.000 N ZNF800 n/a
2 TRCN0000415201 TTTAGAGATCAGAGCTATAAA pLKO_005 2462 CDS 100% 15.000 21.000 N ZNF800 n/a
3 TRCN0000436316 AGTTGTCCAGTATGTTGTAAA pLKO_005 1659 CDS 100% 13.200 18.480 N ZNF800 n/a
4 TRCN0000434895 TGACGTCGGTATTGAAGTAAA pLKO_005 2606 CDS 100% 13.200 18.480 N ZNF800 n/a
5 TRCN0000267550 GGCCGAAGTACAAGATCTAAG pLKO_005 2760 CDS 100% 10.800 15.120 N Zfp800 n/a
6 TRCN0000426830 TCGAGGACTGATAATCCTATT pLKO_005 1239 CDS 100% 10.800 15.120 N ZNF800 n/a
7 TRCN0000021156 CCGAAGTTCAGATACAGGAAA pLKO.1 1294 CDS 100% 4.950 6.930 N ZNF800 n/a
8 TRCN0000021154 GCCATAAATGATCTCCTAGAA pLKO.1 1131 CDS 100% 4.950 6.930 N ZNF800 n/a
9 TRCN0000436209 GATGCTGTGAACCAGTTTATA pLKO_005 844 CDS 100% 15.000 10.500 N ZNF800 n/a
10 TRCN0000255248 ATCTCCTAGAAGCCATATATC pLKO_005 1141 CDS 100% 13.200 9.240 N Zfp800 n/a
11 TRCN0000021155 CGTGATGTGATACGACATATA pLKO.1 2391 CDS 100% 13.200 9.240 N ZNF800 n/a
12 TRCN0000431822 GACAACCTTCCTGATGTAAAT pLKO_005 1095 CDS 100% 13.200 9.240 N ZNF800 n/a
13 TRCN0000255247 GGACTAAGGAGGGATTCAATT pLKO_005 1731 CDS 100% 13.200 9.240 N Zfp800 n/a
14 TRCN0000021157 CTGGATTCTATTTCTCCTAAA pLKO.1 1791 CDS 100% 10.800 7.560 N ZNF800 n/a
15 TRCN0000021158 GCTGGCTTTGACTTTAAGCAA pLKO.1 2232 CDS 100% 3.000 2.100 N ZNF800 n/a
16 TRCN0000427081 AGACATCCAAATCTGGTATTC pLKO_005 907 CDS 100% 10.800 6.480 N ZNF800 n/a
17 TRCN0000255250 GTCGGAAACGTGATGTGATAA pLKO_005 2383 CDS 100% 13.200 18.480 N Zfp800 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715867.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05146 pDONR223 100% 91.4% 91.4% None 1993_2178del n/a
2 ccsbBroad304_05146 pLX_304 0% 91.4% 91.4% V5 1993_2178del n/a
3 TRCN0000480689 AACTGACACCCCATTACTACCTTT pLX_317 20.5% 91.4% 91.4% V5 1993_2178del n/a
Download CSV