Transcript: Human XM_006715880.3

PREDICTED: Homo sapiens EPH receptor A1 (EPHA1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EPHA1 (2041)
Length:
3290
CDS:
61..2646

Additional Resources:

NCBI RefSeq record:
XM_006715880.3
NBCI Gene record:
EPHA1 (2041)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715880.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314982 CAGTTTAGCCACCCGCATATT pLKO_005 1750 CDS 100% 13.200 18.480 N EPHA1 n/a
2 TRCN0000314981 TGTGGCCATTAAGACCTTAAA pLKO_005 1671 CDS 100% 13.200 18.480 N EPHA1 n/a
3 TRCN0000006401 CGCCAAGGAAGTTACTCTGAT pLKO.1 132 CDS 100% 4.950 6.930 N EPHA1 n/a
4 TRCN0000006398 ACTAGGCTATCGGTGCTGCTT pLKO.1 2746 3UTR 100% 2.640 3.696 N EPHA1 n/a
5 TRCN0000314980 ACTAGGCTATCGGTGCTGCTT pLKO_005 2746 3UTR 100% 2.640 3.696 N EPHA1 n/a
6 TRCN0000314913 TACCTGTGAGAGCGGCCATTA pLKO_005 993 CDS 100% 0.000 0.000 N EPHA1 n/a
7 TRCN0000380750 AGATTGTAGCCGTCATCTTTG pLKO_005 1355 CDS 100% 10.800 8.640 N EPHA1 n/a
8 TRCN0000380903 AGCGCATTCTTTGCAGTATTC pLKO_005 2609 CDS 100% 10.800 8.640 N EPHA1 n/a
9 TRCN0000380383 ATGAGCAATCAGGAGGTTATG pLKO_005 2203 CDS 100% 10.800 7.560 N EPHA1 n/a
10 TRCN0000006400 CCGATCATGATCATCACAGAA pLKO.1 1804 CDS 100% 4.950 3.465 N EPHA1 n/a
11 TRCN0000006399 GCCAGAAACATCTTGGTGAAT pLKO.1 1969 CDS 100% 4.950 3.465 N EPHA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715880.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14625 pDONR223 0% 88.1% 88.1% None 479T>C;988_989ins345 n/a
2 ccsbBroad304_14625 pLX_304 0% 88.1% 88.1% V5 479T>C;988_989ins345 n/a
3 TRCN0000470123 TCAGTCTCGTAAGAGAGCTGTTAG pLX_317 15.7% 88.1% 88% V5 (many diffs) n/a
4 ccsbBroadEn_06167 pDONR223 100% 88% 88% None (many diffs) n/a
5 ccsbBroad304_06167 pLX_304 0% 88% 88% V5 (many diffs) n/a
6 TRCN0000476673 TGAAGGTTCAAGTTTATTGGGATC pLX_317 13.5% 88% 88% V5 (many diffs) n/a
Download CSV