Transcript: Human XM_006716285.3

PREDICTED: Homo sapiens glutamic-oxaloacetic transaminase 1 like 1 (GOT1L1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GOT1L1 (137362)
Length:
2305
CDS:
474..1646

Additional Resources:

NCBI RefSeq record:
XM_006716285.3
NBCI Gene record:
GOT1L1 (137362)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006716285.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151997 CAGGAAGAAGCACATCTATAT pLKO.1 1475 CDS 100% 13.200 9.240 N GOT1L1 n/a
2 TRCN0000153775 CCAGTCTCTGTCCAAGAATTT pLKO.1 1112 CDS 100% 13.200 9.240 N GOT1L1 n/a
3 TRCN0000153774 CAGCTGTATCAATGCCAACAA pLKO.1 1520 CDS 100% 4.950 3.465 N GOT1L1 n/a
4 TRCN0000152819 GAGCAAGCAGATATTCCCATT pLKO.1 992 CDS 100% 4.050 2.835 N GOT1L1 n/a
5 TRCN0000152611 GCAGCTTGTTAAAGACCTACA pLKO.1 526 CDS 100% 4.050 2.835 N GOT1L1 n/a
6 TRCN0000103439 GCCTGAAATCATTCATCCAGT pLKO.1 697 CDS 100% 2.640 1.848 N Got1l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006716285.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09571 pDONR223 100% 92.5% 92.3% None 517_518ins93;575A>G n/a
2 ccsbBroad304_09571 pLX_304 0% 92.5% 92.3% V5 517_518ins93;575A>G n/a
3 TRCN0000478124 TGACCACTGTCTTATGATCCGACG pLX_317 19.7% 92.5% 92.3% V5 517_518ins93;575A>G n/a
Download CSV