Transcript: Human XM_006716455.3

PREDICTED: Homo sapiens ATPase H+ transporting V1 subunit H (ATP6V1H), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP6V1H (51606)
Length:
1861
CDS:
170..1567

Additional Resources:

NCBI RefSeq record:
XM_006716455.3
NBCI Gene record:
ATP6V1H (51606)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006716455.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233553 GACCAGCAGGTCCGCTATAAT pLKO_005 1448 CDS 100% 15.000 21.000 N ATP6V1H n/a
2 TRCN0000043047 CGCTATAATATCATTCCAGTT pLKO.1 899 CDS 100% 4.050 5.670 N ATP6V1H n/a
3 TRCN0000233551 GAGAATGCTGTGAGGTTAAAT pLKO_005 1247 CDS 100% 15.000 10.500 N ATP6V1H n/a
4 TRCN0000043043 CCTGGCATTCAGTCCTCAAAT pLKO.1 862 CDS 100% 13.200 9.240 N ATP6V1H n/a
5 TRCN0000369407 CTTTCAGCTCCAGTATCAAAT pLKO_005 823 CDS 100% 13.200 9.240 N ATP6V1H n/a
6 TRCN0000233552 GAGAATATGTGCGGCATTATC pLKO_005 1359 CDS 100% 13.200 9.240 N ATP6V1H n/a
7 TRCN0000369327 GGATCCCTTCACTGTTCATAT pLKO_005 568 CDS 100% 13.200 9.240 N ATP6V1H n/a
8 TRCN0000043046 CCGTTCAGTATATACTAACTA pLKO.1 435 CDS 100% 5.625 3.938 N ATP6V1H n/a
9 TRCN0000043045 GCAAACAAAGTCAACTGGCAA pLKO.1 251 CDS 100% 2.640 1.848 N ATP6V1H n/a
10 TRCN0000233554 TTGGAATTTCCTCTGTTATAT pLKO_005 1659 3UTR 100% 15.000 9.000 N ATP6V1H n/a
11 TRCN0000043044 GCTCACGATGTTGGAGAATAT pLKO.1 1346 CDS 100% 13.200 7.920 N ATP6V1H n/a
12 TRCN0000289794 GCTCACGATGTTGGAGAATAT pLKO_005 1346 CDS 100% 13.200 7.920 N ATP6V1H n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006716455.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03343 pDONR223 100% 96.2% 96.2% None 525_526ins54 n/a
2 ccsbBroad304_03343 pLX_304 0% 96.2% 96.2% V5 525_526ins54 n/a
Download CSV