Transcript: Human XM_006716595.2

PREDICTED: Homo sapiens oxidation resistance 1 (OXR1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OXR1 (55074)
Length:
4387
CDS:
95..2638

Additional Resources:

NCBI RefSeq record:
XM_006716595.2
NBCI Gene record:
OXR1 (55074)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006716595.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432951 ACCTGGATTTATAGTAGTAAA pLKO_005 1969 CDS 100% 13.200 18.480 N OXR1 n/a
2 TRCN0000158922 CCTAACGAACTTGTTCAATTA pLKO.1 452 CDS 100% 13.200 18.480 N OXR1 n/a
3 TRCN0000161574 GCAGAAGATACTGGCGAATAT pLKO.1 1940 CDS 100% 13.200 18.480 N OXR1 n/a
4 TRCN0000412543 CAATTGAGGATTCTAGTAATC pLKO_005 2010 CDS 100% 10.800 15.120 N OXR1 n/a
5 TRCN0000424122 GAATCCGAGATGCAGGTAATG pLKO_005 1038 CDS 100% 10.800 15.120 N OXR1 n/a
6 TRCN0000160280 CGTACACTTTCTAAGAAGGAA pLKO.1 2576 CDS 100% 3.000 4.200 N OXR1 n/a
7 TRCN0000160648 CCCATACTATGCAACAAACTA pLKO.1 1620 CDS 100% 5.625 4.500 N OXR1 n/a
8 TRCN0000417847 ATTAGTCTGTATCACCATTTA pLKO_005 2748 3UTR 100% 13.200 9.240 N OXR1 n/a
9 TRCN0000160430 CCATAGATATAGATCAGCTAT pLKO.1 954 CDS 100% 4.950 3.465 N OXR1 n/a
10 TRCN0000159728 GCATCGATTACATAAGTTCTT pLKO.1 1750 CDS 100% 4.950 3.465 N OXR1 n/a
11 TRCN0000159799 GCCATTAAGGAAGATCAGATT pLKO.1 1355 CDS 100% 4.950 3.465 N OXR1 n/a
12 TRCN0000162084 CCTCATCTACTTTCACTGGTA pLKO.1 654 CDS 100% 2.640 1.848 N OXR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006716595.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12152 pDONR223 100% 89.4% 89.4% None 1_267del n/a
2 ccsbBroad304_12152 pLX_304 0% 89.4% 89.4% V5 1_267del n/a
3 TRCN0000479891 ATGGAGTACCAACCTGCCATGTTC pLX_317 19% 89.4% 89.4% V5 1_267del n/a
Download CSV