Transcript: Human XM_006717108.3

PREDICTED: Homo sapiens family with sequence similarity 166 member A (FAM166A), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM166A (401565)
Length:
1064
CDS:
44..949

Additional Resources:

NCBI RefSeq record:
XM_006717108.3
NBCI Gene record:
FAM166A (401565)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717108.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142981 CAAAGCGAAACCACACACTAT pLKO.1 927 CDS 100% 4.950 6.930 N FAM166A n/a
2 TRCN0000121721 CATGTCCAAACCCAAGTTCAT pLKO.1 322 CDS 100% 4.950 6.930 N FAM166A n/a
3 TRCN0000142090 GCAAAGCGAAACCACACACTA pLKO.1 926 CDS 100% 4.950 6.930 N FAM166A n/a
4 TRCN0000143230 GAGCCAGTTCCTGTTTAGAAA pLKO.1 736 CDS 100% 5.625 3.938 N FAM166A n/a
5 TRCN0000142072 CCATGTCCAAACCCAAGTTCA pLKO.1 321 CDS 100% 4.950 3.465 N FAM166A n/a
6 TRCN0000142031 GACAAGAGCCAGTTCCTGTTT pLKO.1 731 CDS 100% 4.950 3.465 N FAM166A n/a
7 TRCN0000141555 CCCAAGTTCATTGAGGACTTC pLKO.1 332 CDS 100% 4.050 2.835 N FAM166A n/a
8 TRCN0000142073 CCCTAACCTAATCCAACGCAA pLKO.1 616 CDS 100% 2.640 1.848 N FAM166A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717108.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05650 pDONR223 100% 75.5% 75.5% None 1_105del;376_377ins153 n/a
2 ccsbBroad304_05650 pLX_304 0% 75.5% 75.5% V5 1_105del;376_377ins153 n/a
3 TRCN0000466702 TCCCTAACAGCGACTTTGAGTTTG pLX_317 44.5% 75.5% 75.5% V5 1_105del;376_377ins153 n/a
Download CSV