Transcript: Human XM_006717278.1

PREDICTED: Homo sapiens XPA, DNA damage recognition and repair factor (XPA), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
XPA (7507)
Length:
1210
CDS:
112..900

Additional Resources:

NCBI RefSeq record:
XM_006717278.1
NBCI Gene record:
XPA (7507)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717278.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358688 GATGATAAACACAAGCTTATA pLKO_005 508 CDS 100% 13.200 18.480 N XPA n/a
2 TRCN0000358757 GTGATATGAAACTCTACTTAA pLKO_005 638 CDS 100% 13.200 18.480 N XPA n/a
3 TRCN0000083197 GACCTGTTATGGAATTTGATT pLKO.1 395 CDS 100% 5.625 4.500 N XPA n/a
4 TRCN0000083196 CATGAGTATGGACCAGAAGAA pLKO.1 841 CDS 100% 4.950 3.465 N XPA n/a
5 TRCN0000083194 GCATTAGAAGAAGCAAAGGAA pLKO.1 706 CDS 100% 3.000 2.100 N XPA n/a
6 TRCN0000083195 GCTGATGATAAACACAAGCTT pLKO.1 505 CDS 100% 3.000 2.100 N XPA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717278.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01783 pDONR223 100% 95.3% 94.8% None (many diffs) n/a
2 ccsbBroad304_01783 pLX_304 0% 95.3% 94.8% V5 (many diffs) n/a
3 TRCN0000479023 CTTGATAATCGTGAGACTTATGAC pLX_317 63.7% 95.3% 94.8% V5 (many diffs) n/a
Download CSV