Transcript: Human XM_006717593.1

PREDICTED: Homo sapiens sorbin and SH3 domain containing 1 (SORBS1), transcript variant X47, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SORBS1 (10580)
Length:
5719
CDS:
211..2433

Additional Resources:

NCBI RefSeq record:
XM_006717593.1
NBCI Gene record:
SORBS1 (10580)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717593.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059704 CCACAACGATTGTCAATCCTA pLKO.1 626 CDS 100% 3.000 4.200 N SORBS1 n/a
2 TRCN0000059706 CCGGAACACTGAGAGATCAAA pLKO.1 873 CDS 100% 5.625 4.500 N SORBS1 n/a
3 TRCN0000059707 CCTCTGCAGAAGGGAGATATT pLKO.1 1765 CDS 100% 13.200 9.240 N SORBS1 n/a
4 TRCN0000059705 GAGAAGCTATTGCTAAGTTTA pLKO.1 1937 CDS 100% 13.200 9.240 N SORBS1 n/a
5 TRCN0000423988 GATTCCAGTCCTCTACTAAAT pLKO_005 529 CDS 100% 13.200 9.240 N SORBS1 n/a
6 TRCN0000412685 TACTCTCCCAGATACTCATTT pLKO_005 958 CDS 100% 13.200 9.240 N SORBS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717593.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11524 pDONR223 100% 58.3% 58% None (many diffs) n/a
2 ccsbBroad304_11524 pLX_304 0% 58.3% 58% V5 (many diffs) n/a
3 TRCN0000478353 GTCCATCCATTACTTGACCACCGT pLX_317 15.8% 58.3% 58% V5 (many diffs) n/a
Download CSV